GPD- roGFP

$218.00

  • Model: PVT11544
  • 50 Units in Stock
Ask a question


Add to Cart:

GPD-roGFP

Catalog No.PVT11544
Packing 2ug


GPD-roGFP Alternative name
GPD-roGFPGPD-roGFP vector, GPD-roGFP plasmid, GPD-roGFP map, GPD-roGFP sequence,

 

GPD-roGFP CLONING INFORMATION

Cloning methodRestriction Enzyme

5′ cloning siteXhoI (not destroyed)

3′ cloning siteBamHI (not destroyed)

5′ sequencing primer5'GGCGTGTACGGTGGGAGGTCTATA-3'

3′ sequencing primer5'-TTAAAAAACCTCCCCACCTCCCCC-3'

 

GPD-roGFP GROWTH IN BACTERIA

Bacterial Resistance(s)  Ampicillin

Growth Temperature  37°C

Growth Strain(s)  NEB Stable

Copy number  High Copy

 

GPD-roGFP Sequence

> EBV-rev 5'-GTGGTTTGTCCAAACTCATC-3'

GCTGTGGCGGCCGCTCTAGAACTAGTGGAtCCTTCTTACTTGTACAGCTCGTCCATGCCGAGAGTGATCC

CGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGA

GCAGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAG

TGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCT

TCTGCTTGTCGGCCATGATATAGACGTTGTGGCAGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTT

GCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACC

TCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCA

TGGCGGACTTGAAGAAGTCGTGCCGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGT

CAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCTGATGAACTTCAGGGTCAGC

TTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCA

GCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATTAAGCTTGCATAATC

AGGAACATCATAATCGATGTCTGGAGGCAGCAGGCTGATTTCAGTACTATCTGTGAGTTGTTCTGTTC

       

 

> CMV-F 5'-CGCAAATGGGCGGTAGGCGTG-3'

AGCaGAgCTcGTTtaGTGACCGTCAGATGGTACCGTTTAAACTCGAGCGGCCGCCAGTGTGATGGATATC

TGCAGAATTCCGCTCGCCGACCCCTGGCGTGTGACGACCGATCTCAGGCTGAGCAATGGCGTTTCAAAAG

GTAGTGAAAGGGACTATTCTTATGGGTGGAGGAGCTCTGGCCACTGTTTTGGGACTCTCTCAGTTTGCTC

ACTACAGAAGGAAGCAAGTAAGCCTGGCGTATGTGGAAGCAGCAACATGCTTCTCAGAGCCCGTGAACAG

GGAGCCTCCTTCCAGAGAAGCTCAGCTCATGACTCTGCAGAACACATCGGAATTTGACATCCTCGTCATT

GGAGGAGGAGCCACAGGATGTGGCTGTGCGCTAGACGCCGTCACCAGAGGACTGAAAACAGCCCTTGTAG

AGAGAAATGACTTCGCATCAGGGACTAGCAGCAGAAGCACTAAATTGATCCATGGTGGCGTACGATACCT

CCAGAAGGCTATCACGAACTTGGATGTTGAACAGTATAGGATGGTGAAAGAGGCCCTTCATGAACGTGCC

AACTTACTAGAAATCGCTCCCCATCTATCAGCTCCGCTGCCTATAATGCTGCCACTTTATAAGTGGTGGC

AGTTACCTTATTACTGGGTGGGAATCAAGATGTATGATCTGGTTGCAGGAAGTCATTGCCTGAAGAGCAG

TT

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart