Lenti dcas VP64- Blast Plasmid

$216.00

  • Model: PVT6318
  • 50 Units in Stock
Ask a question


Add to Cart:

Lenti dcas VP64-Blast

Search name

Lenti dcas VP64-Blast,Plasmid Lenti dcas VP64-Blast,Lenti dcas VP64-Blast vector

 

Lenti dcas VP64-Blast Information

Plasmid type: CRISPR/Cas9 vector; gene knockout vector; mammalian vector

High copy / low copy: high copy

Cloning method: BsiWI, EcoRI

Promoter: EF1

Carrier size: 14085 BP

5'sequencing primers and sequences: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG

3'sequencing primers and sequences: cacatagcgtaaaaggagcaacatag

Carrier label: -

Vector resistance: ampicillin (Ampicilin)

Screening markers: Blasticidin

Cloned strain: Stbl3

Host cells (lines): mammalian cells

Note: Mutation D10A and N863A in Cas9

Stability: stable expression

Composition / inducible type: composition

Virus / non virus: slow disease

Use:CRISPR-CAS27-sgRNA plasmid

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart