lenti-EF1a-dCas9-KRAB-Puro vector

$242.00

  • Model: PVT12069
  • 50 Units in Stock
Ask a question


Add to Cart:

lenti-EF1a-dCas9-KRAB-Puro vector

Cat. PVT12069

Packing 2ug

 

lenti-EF1a-dCas9-KRAB-Puro vector Information

Product Name: lenti-EF1a-dCas9-KRAB-Puro vector

Bacterial Resistance: Amp

Selectable markers: Puro

Growth Strain: Stbl3

Growth Temperature: LB/37Centigrade degree

Copy number: High Copy

5′ sequencing primer: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG

3′ sequencing primer: cacatagcgtaaaaggagcaacatag


Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart