lentiGuide-Puro

$198.00

  • Model: PVT6316
  • 49 Units in Stock
Ask a question


Add to Cart:

lentiGuide-Puro

PVT6316         2ug

Search name

lentiGuide-Puro,Plasmid lentiGuide-Puro,lentiGuide-Puro vector

 

lentiGuide-Puro Information

Bacterial Resistance:Ampicillin
Growth Strain:

Use:CRISPR-CAS25-sgRNA plasmid

 

lentiGuide-Puro Description

Vector backbone Custom
Backbone size w/o insert (bp) 9482
Vector type Mammalian Expression, Lentiviral, CRISPR
Selectable markers Puromycin

Gene/Insert name S. pyogenes sgRNA cassette
Alt name S. pyogenes CRISPR customizable RNA element
Species Synthetic
Insert Size (bp) 100
Promoter hU6

Bacterial Resistance(s) Ampicillin
Growth Temperature 37°C
Growth Strain(s) Stbl3
Growth instructions Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
Copy number High Copy

Cloning method Restriction Enzyme
5′ cloning site BsmBI (not destroyed)
3′ cloning site BsmBI (not destroyed)
5′ sequencing primer hU6-F
3′ sequencing primer hGata4-rev (5'-ATTGTGGATGAATACTGCC-3')

Gene/Insert name Puromycin resistance
Alt name puromycin N-acetyl-transferase
Alt name PAC
Insert Size (bp) 600
Promoter Ef1-a

Cloning method Restriction Enzyme
5′ cloning site BsiWI (not destroyed)
3′ cloning site MluI (not destroyed)
5′ sequencing primer EF-1a-F
3′ sequencing primer WPRE-R

 

lentiGuide-Puro Sequence

cccgggtgcaaagatggataaagttttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtg
ggaattggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaa
ttgatccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagg
gtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggta
agtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggct
gcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagcccctt
cgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctc
gctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgt
aaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgca
catgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctg
gtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcgga
aagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcac
ccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcac
ctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacac
tgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggat
cttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgacgtacggccaccatg
accgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgc
cgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctca
cgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgccgtggcggtctggaccacgccggagagc
gtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaaca
gatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggagtctcgcccgaccacc
agggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggag
acctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggacc
gcgcacctggtgcatgacccgcaagcccggtgcctgaacgcgttaagtcgacaatcaacctctggattacaaaatttgtg
aaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgct
attgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgt
tgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagc
tcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggaca
ggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgt
tgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcc
tgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccg
cgtcgactttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaaggg
ctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctggga
gctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtc
tgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtacgtatagtagt
tcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagc
ttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtt
tgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccgcccctaactc
cgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctct
gagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtattac
gcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcaca
tccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcg
aatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagc
gccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcg
ggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgta
gtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaa
actggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaa
aaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttaggtggcacttttcgggg
aaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgat
aaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggca
ttttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtggg
ttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcactt
ttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattct
cagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgc
tgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttt
tgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgt
gacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggca
acaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattg
ctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatc
gtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgat
taagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaagga
tctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacccc
gtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgct
accagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatac
caaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctg
ctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgga
taaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagat
acctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtc
ggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctg
acttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggt
tcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcc
tttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgccc
aatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgg
gcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgt
atgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaa
ccctcactaaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactcttgtagtcttgcaacatggt
aacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatc
gtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgta
tttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagg
gaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggta
actagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaag
ggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtg
agtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaat
tagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagca
gggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaa
ccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggat
agagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcgg
ccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaat
tgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctt
tgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaatta
ttgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctg
gggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggtt
gctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaat
cacacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaa
ccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaatt
ggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctata
gtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccagagagggcct
atttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaaca
caaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaa
atggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttGTGGAAAGGACGAAACAC
CgGAGACGGTTGTAAATGAGCACACAAAATACACATGCTAAAATATTATATTCTATGACCTTTATAAAATCAACCAAAAT
CTTCTTTTTAATAACTTTAGTATCAATAATTAGAATTTTTATGTTCCTTTTTGCAAACTTTTAATAAAAATGAGCAAAAT
AAAAAAACGCTAGTTTTAGTAACTCGCGTTGTTTTCTTCACCTTTAATAATAGCTACTCCACCACTTGTTCCTAAGCGGT
CAGCTCCTGCTTCAATCATTTTTTGAGCATCTTCAAATGTTCTAACTCCACCAGCTGCTTTAACTAAAGCATTGTCTTTA
ACAACTGACTTCATTAGTTTAACATCTTCAAATGTTGCACCTGATTTTGAAAATCCTGTTGATGTTTTAACAAATTCTAA
TCCAGCTTCAACAGCTATTTCACAAGCTTTCATGATTTCTTCTTTTGTTAATAAACAATTTTCCATAATACATTTAACAA
CATGTGATCCAGCTGCTTTTTTTACAGCTTTCATGTCTTCTAAAACTAATTCATAATTTTTGTCTTTTAATGCACCAATA
TTTAATACCATATCAATTTCTGTTGCACCATCTTTAATTGCTTCAGAAACTTCGAATGCTTTTGTAGCTGTTGTGCATGC
ACCTAGAGGAAAACCTACAACATTTGTTATTCCTACATTTGTGCCTTTTAATAATTCTTTACAATAGCTTGTTCAATATG
AATTAACACAAACTGTTGCAAAATCAAATTCAATTGCTTCATCACATAATTGTTTAATTTCAGCTTTCGTAGCATCTTGT
TTTAATAATGTGTGATCTATATATTTGTTTAGTTTCATTTTTTCTCCTATATATTCATTTTTAATTTTAATTCTTTAATA
ATTTCGTCTACTTTAACTTTAGCGTTTTGAACAGATTCACCAACACCTATAAAATAAATTTTTAGTTTAGGTTCAGTTCC
ACTTGGGCGAACAGCAAATCATGACTTATCTTCTAAATAAAATTTTAGTAAGTCTTGTCCTGGCATATTATACATTCCAT
CGATGTAGTCTTCAACATTAACAACTTTAAGTCCAGCAATTTGAGTTAAGGGTGTTGCTCTCAATGATTTCATTAATGGT
TCAATTTTTAATTTCTTTTCTTCTGGTTTAAAATTCAAGTTTAAAGTGAAAGTGTAATATGCACCCATTTCTTTAAATAA
ATCTTCTAAATAGTCTACTAATGTTTTATTTTGTTTTTTATAAAATCAAGCAGCCTCTGCTATTAATATAGAAGCTTGTA
TTCCATCTTTATCTCTAGCTGAGTCATCAATTACATATCCATAACTTTCTTCATAAGCAAAAACAAAATTTAATCCGTTA
TCTTCTTCTTTAGCAATTTCTCTACCCATTCATTTAAATCCAGTTAAAGTTTTTACAATATTAACTCCATATTTTTCATG
AGCGATTCTATCACCCAAATCACTTGTTACAAAACTTGAATATAGAGCCGGATTTTTTGGAATGCTATTTAAGCGTTTTA
GATTTGATAATTTTCAATCAATTAAAATTGGTCCTGTTTGATTTCCATCTAATCTTACAAAATGACCATCATGTTTTATT
GCCATTCCAAATCTGTCAGCATCTGGGTCATTCATAATAATAATATCTGCATCATGTTTAATACCATATTCAAGCGGTAT
TTTTCATGCAGGATCAAATTCTGGATTTGGATTTACAACATTTTTAAATGTTTCATCTTCAAATGCATGCTCTTCAACCT
CAATAACGTTATATCCTGATTCACGTAATATTTTTGGGGTAAATTTAGTTCCTGTTCCATTAACTGCGCTAAAAATAATT
TTTAAATCTTTTTTAGCTTCTTGCTCTTTTTTGTACGTCTCTgttttagagctaGAAAtagcaagttaaaataaggctag
tccgttatcaacttgaaaaagtggcaccgagtcggtgcTTTTTTaagcttggcgtaactagatcttgagacaaatggcag
tattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaaca
gacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatcc
actttggcgccggctcgaggggg

//

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart