lentiMPH v2

$182.00

  • Model: PVT10984
  • 50 Units in Stock
Ask a question


Add to Cart:

lentiMPH v2


Catalog No. PVT10984
Packing 2ug

 

lentiMPH v2 Information

Function Mammal Editing plasmids

Prokaryotic resistance: ampicillin Amp

Screening markers: hygromycin Hyg, bleomycin Zeo

Cloned strain: Escherichia coli Stbl3

Culture conditions: 37 degrees centigrade

 

lentiMPH v2 Desciprion

LentiMPH V2 is a mammalian Cas9 expression plasmid.

 

lentiMPH v2  Sequence

CACTGCTCTTTTTTCTCTCTGCACCACTCTTCTCTTTGCCTTGGTGGGTGCTACTCCTAATGGTTCAATTTTTACTACTT
TATATTTATATAATTCACTTCTCCAATTGTCCCTCATATCTCCTCCTCCAGGTCTGAAGATCAGCGGCCGCTTGCTGTGC
GGTGGTCTTACTTTTGTTTTGCTCTTCCTCTATCTTGTCTAAAGCTTCCTTGGTGTCTTTTATCTCTATCCTTTGATGCA
CACAATAGAGGGTTGCTACTGTATTATATAATGATCTAAGTTCTTCTGATCCTGTCTGAAGGGATGGTTGTAGCTGTCCC
AGTATTTGTCTACAGCCTTCTGATGTTTCTAACAGGCCAGGATTAACTGCGAATCGTTCTAGCTCCCTGCTTGCCCATAC
TATATGTTTTAATTTATATTTTTTCTTTCCCCCTGGCCTTAACCGAATTTTTTCCCATCGCGATCTAATTCTCCCCCGCT
TAATACTGACGCTCTCGCACCCATCTCTCTCCTTCTAGCCTCCGCTAGTCAAAATTTTTGGCGTACTCACCAGTCGCCGC
CCCTCGCCTCTTGCCGTGCGCGCTTCAGCAAGCCGAGTCCTGCGTCGAGAGAGCTCCTCTGGTTTCCCTTTCGCTTTCAA
GTCCCTGTTCGGGCGCCACTGCTAGAGATTTTCCACACTGACTAAAAGGGTCTGAGGGATCTCTAGTTACCAGAGTCACA
CAACAGACGGGCACACACTACTTGAAGCACTCAAGGCAAGCTTTATTGAGGCTTAAGCAGTGGGTTCCCTAGTTAGCCAG
AGAGCTCCCAGGCTCAGATCTGGTCTAACCAGAGAGACCCAGTACAGGCAAAACGCGCTGCTTATATAGACCTCCCACCG
TACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAA
ACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGATGTAC
TGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCATAAGGTCAT
GTACTGGGCATAATGCCAGGCGGGCCATTTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGAT
GTACTGCCAAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGA
ACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAAC
GCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAAC
GCGTATATCTGGCCCGTACATCGCGAAGCAGCGCAAAACGCCTAACCCTAAGCAGATTCTTCATGCAATTGTCGGTCAAG
CCTTGCCTTGTTGTAGCTTAAATTTTGCTCGCGCACTACTCAGCGACCTCCAACACACAAGCAGGGAGCAGATACTGGCT
TAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAGGGGATCGGGAGATCTCCCGATCCGTCGACGTCAGG
TGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGA
GACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATT
CCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTT
GGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTC
CAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGC
CGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAG
AGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGG
AGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATA
CCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTAC
TCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGG
CTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGT
AAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGAT
AGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATT
TTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCAC
TGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAAC
AAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCA
GCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCT
ACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG
ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCT
ACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCG
GTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGG
GTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACG
CGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGAT
AACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGA
AGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTC
CCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTT
ATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGC
CAAGCTCTAGCTAGAGGTCGACGGTATACAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCA
GTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTG
GGGTGGGCGAAGAACTCCAGCATGAGATCCCCGCGCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCC
CAACCTTTCATAGAAGGCGGCGGTGGAATCGAAATCTCGTAGCACGTGTCAGTCCTGCTCCTCGGCCACGAAGTGCACGC
AGTTGCCGGCCGGGTCGCGCAGGGCGAACTCCCGCCCCCACGGCTGCTCGCCGATCTCGGTCATGGCCGGCCCGGAGGCG
TCCCGGAAGTTCGTGGACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAGGCCAGGGT
GTTGTCCGGCACCACCTGGTCCTGGACCGCGCTGATGAACAGGGTCACGTCGTCCCGGACCACACCGGCGAAGTCGTCCT
CCACGAAGTCCCGGGAGAACCCGAGCCGGTCGGTCCAGAACTCGACCGCTCCGGCGACGTCGCGCGCGGTGAGCACCGGA
ACGGCACTGGTCAACTTGGCCATGGTTTAGTTCCTCACCTTGTCGTATTATACTATGCCGATATACTATGCCGATGATTA
ATTGTCAACACGTGCTGATCAGATCCGAAAATGGATATACAAGCTCCCGGGAGCTTTTTGCAAAAGCCTAGGCCTCCAAA
AAAGCCTCCTCACTACTTCTGGAATAGCTCAGAGGCAGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGC
CATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGAC
TAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAG
ATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGAATTA
ATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAG
AATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAA
GGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCG
TAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGG
AAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCC
GCGCTTAATGCGCCGCTACAGGGCGCGTGGGGATACCCCCTAGAGCCCCAGCTGGTTCTTTCCGCCTCAGAAGCCATAGA
GCCCACCGCATCCCCAGCATGCCTGCTATTGTCTTCCCAATCCTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAA
TAGAATGACACCTACTCAGACAATGCGATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCACCTTCCAGG
GTCAAGGAAGGCACGGGGGAGGGGCAAACAACAGATGGCTGGCAACTAGAAGGCACAGTCGAGGCTGATCAGCGGGTTTA
AACGGGCCCTGCTAGAGATTTTCCACACTGACTAAAAGGGTCTGAGGGATCTCTAGTTACCAGAGTCACACAACAGACGG
GCACACACTACTTGAAGCACTCAAGGCAAGCTTTATTGAGGCTTAAGCAGTGGGTTCCCTAGTTAGCCAGAGAGCTCCCA
GGCTCAGATCTGGTCTAACCAGAGAGACCCAGTACAGTCCGGATGCAGCTCTCGGGCCATGTGATGAAATGCTAGGCGGC
TGTCAAACCTCCACTCTAATACTTCTCTCTCCGGGTCATCCATCCCATGCAGGCTCACAGGGTGTAACAAGCGGGTGTTC
TCTCCTTCATTGGCTTCTTCTACCTTCTCTTGCTCAACTGGTACTAGCTTGTAGCACCATCCAAAGGTCAGTGGATATCT
GATCCCTGGCCCTGGTGTGTAGTTCTGCCAATCAGGGAAGTAGCCTTGTGTGTGGTAGATCCACAGATCAAGGATATCTT
GTCTTCGTTGGGAGTGAATTAGCCCTTCCAGTCCCCCCTTTTCTTTTAAAAAGTGGCTAAGATCTACAGCTGCCTTGTAA
GTCATTGGTCTTAAAGGTACCTGAGGTGTGACTGGAAAACCCACCTCCTCCTCCTCTTGTGCTTCTAGCCAGGCACAATC
AGCATTGGTAGCTGCTGTATTGCTACTTGTGATTGCTCCATGTTTTTCTAGGTCTCGAGGTCGACGGTATCGATTGCAAA
GATGGATAAAGTTTTAAACAGAGAGGAATCTTTGCAGCTAATGGACCTTCTAGGTCTTGAAAGGAGTGGGAATTGGCTCC
GGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGC
CTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAAC
CGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGT
GGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGAT
TCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTT
GAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGAT
AAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCA
AGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGA
GGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTC
GCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCT
TCCCGGCCCTGCTGCAGGGAGCTCAAAATGAAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGA
AAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTC
TCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGA
GACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTC
TCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGACGTACGGCCACCATGGCTTCAAACTTT
ACTCAGTTCGTGCTCGTGGACAATGGTGGGACAGGGGATGTGACAGTGGCTCCTTCTAATTTCGCTAATGGGGTGGCAGA
GTGGATCAGCTCCAACTCACGGAGCCAGGCCTACAAGGTGACATGCAGCGTCAGGCAGTCTAGTGCCCAGAAGAGAAAGT
ATACCATCAAGGTGGAGGTCCCCAAAGTGGCTACCCAGACAGTGGGCGGAGTCGAACTGCCTGTCGCCGCTTGGAGGTCC
TACCTGAACATGGAGCTCACTATCCCAATTTTCGCTACCAATTCTGACTGTGAACTCATCGTGAAGGCAATGCAGGGGCT
CCTCAAAGACGGTAATCCTATCCCTTCCGCCATCGCCGCTAACTCAGGTATCTACAGCGCTGGAGGAGGTGGAAGCGGAG
GAGGAGGAAGCGGAGGAGGAGGTAGCGGACCTAAGAAAAAGAGGAAGGTGGCGGCCGCTGGATCCCCTTCAGGGCAGATC
AGCAACCAGGCCCTGGCTCTGGCCCCTAGCTCCGCTCCAGTGCTGGCCCAGACTATGGTGCCCTCTAGTGCTATGGTGCC
TCTGGCCCAGCCACCTGCTCCAGCCCCTGTGCTGACCCCAGGACCACCCCAGTCACTGAGCGCTCCAGTGCCCAAGTCTA
CACAGGCCGGCGAGGGGACTCTGAGTGAAGCTCTGCTGCACCTGCAGTTCGACGCTGATGAGGACCTGGGAGCTCTGCTG
GGGAACAGCACCGATCCCGGAGTGTTCACAGATCTGGCCTCCGTGGACAACTCTGAGTTTCAGCAGCTGCTGAATCAGGG
CGTGTCCATGTCTCATAGTACAGCCGAACCAATGCTGATGGAGTACCCCGAAGCCATTACCCGGCTGGTGACCGGCAGCC
AGCGGCCCCCCGACCCCGCTCCAACTCCCCTGGGAACCAGCGGCCTGCCTAATGGGCTGTCCGGAGATGAAGACTTCTCA
AGCATCGCTGATATGGACTTTAGTGCCCTGCTGTCACAGATTTCCTCTAGTGGGCAGGGAGGAGGTGGAAGCGGCTTCAG
CGTGGACACCAGTGCCCTGCTGGACCTGTTCAGCCCCTCGGTGACCGTGCCCGACATGAGCCTGCCTGACCTTGACAGCA
GCCTGGCCAGTATCCAAGAGCTCCTGTCTCCCCAGGAGCCCCCCAGGCCTCCCGAGGCAGAGAACAGCAGCCCGGATTCA
GGGAAGCAGCTGGTGCACTACACAGCGCAGCCGCTGTTCCTGCTGGACCCCGGCTCCGTGGACACCGGGAGCAACGACCT
GCCGGTGCTGTTTGAGCTGGGAGAGGGCTCCTACTTCTCCGAAGGGGACGGCTTCGCCGAGGACCCCACCATCTCCCTGC
TGACAGGCTCGGAGCCTCCCAAAGCCAAGGACCCCACTGTCTCCTGTACAGGCAGTGGAGAGGGCAGAGGAAGTCTGCTA
ACATGCGGTGACGTCGAGGAGAATCCTGGCCCAACCATGAAAAAGCCTGAACTCACCGCTACCTCTGTCGAGAAGTTTCT
GATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCCGAGGGCGAAGAATCTCGGGCTTTCAGCTTCGATGTGG
GAGGGCGTGGATATGTCCTGCGGGTGAATAGCTGCGCCGATGGTTTCTACAAAGATCGCTATGTTTATCGGCACTTTGCA
TCCGCCGCTCTCCCTATTCCCGAAGTGCTTGACATTGGGGAGTTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGC
ACAGGGTGTCACCTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTCCAGCCCGTCGCCGAGGCCATGGATGCCA
TCGCTGCCGCCGATCTTAGCCAGACCAGCGGGTTCGGCCCATTCGGACCTCAAGGAATCGGTCAATACACTACATGGCGC
GATTTCATCTGCGCTATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCCTCCGTCGC
CCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCCGATTTCGGCTCCA
ACAATGTCCTGACCGACAATGGCCGCATAACAGCCGTCATTGACTGGAGCGAGGCCATGTTCGGGGATTCCCAATACGAG
GTCGCCAACATCTTCTTCTGGAGGCCCTGGTTGGCTTGTATGGAGCAGCAGACCCGCTACTTCGAGCGGAGGCATCCCGA
GCTTGCAGGATCTCCTCGGCTCCGGGCTTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCA
ATTTCGATGATGCAGCTTGGGCTCAGGGTCGCTGCGACGCAATCGTCCGGTCCGGAGCCGGGACTGTCGGGCGTACACAA
ATCGCCCGCAGAAGCGCTGCCGTCTGGACCGATGGCTGTGTGGAAGTGCTCGCCGATAGTGGAAACAGACGCCCCAGCAC
TCGTCCTAGGGCAAAGGATCTGCAGTAATGAGAATTCGATATCAAGCTTATCGGTAATCAACCTCTGGATTACAAAATTT
GTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCAT
GCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCC
CGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTC
AGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGG
ACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTG
TGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCG
GCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC
CCGCATCGCTAGCTAATTAACCAAACTGGATCTCTGCTGTCCCTGTAATAAACCCGAAAATTTTGAATTTTTGTAATTTG
TTTTTGTAATTCTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCCCCTGCACTGTACCCCCCAATCCCCC
CTTTTCTTTTAAAATTGTGGATGAATACTGCCATTTGTCTGCAGAATTGGCGCACGCAGTGCCGATCCGTTCACTAATCG
AATGGATCTGTCTCTGTCTCTCTCTCCACCTTCTTCTTCTATTCCTTCGGGCCTGTCGGGTCCCCTCGGGGTTGGGAGGT
GGGTCTGAAACGATAATGGTGAATATCCCTGCCTAACTCTATTCACTATAGAAAGTACAGCAAAAACTATTCTTAAACCT
ACCAAGCCTCCTACTATCATTATGAATAATTTTATATACCACAGCCAATTTGTTATGTTAAACCAATTCCACAAACTTGC
CCATTTATCTAATTCCAATAATTCTTGTTCATTCTTTTCTTGCTGGTTTTGCGATTCTTCAATTAAGGAGTGTATTAAGC
TTGTGTAATTGTTAATTTCTCTGTCCCACTCCATCCAGGTCGTGTGATTCCAAATCTGTTCCAGAGATTTATTACTCCAA
CTAGCATTCCAAGGCACAGCAGTGGTGCAAATGAGTTTTCCAGAGCAACCCCAAATCCCCAGGAGCTGTTGATCCTTTAG
GTATCTTTCCACAGCCAGGATTCTTGCCTGGAGCTGCTTGATGCCCCAGACTGTGAGTTGCAACAGATGCTGTTGCGCCT
CAATAGCCCTCAGCAAATTGTTCTGCTGCTGCACTATACCAGACAATAATTGTCTGGCCTGTACCGTCAGCGTCATTGAC
GCTGCGCCCATAGTGCTTCCTGCTGCTCCCAAGAACCCAAGGAACAAAGCTCCTATTCC

//
 
Caution:
1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.
No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart