p2CT-His-MBP-Lba_Cas13a_WT

$192.00

  • Model: PVT17443
  • 50 Units in Stock
Ask a question


Add to Cart:

p2CT-His-MBP-Lba_Cas13a_WT

 

Product Name: p2CT-His-MBP-Lba_Cas13a_WT
Cat No.: PVT17443
Alternative Name: p2CT-His-MBP-Lba_Cas13a_WT,p2CT-His-MBP-Lba_Cas13a_WT vector,p2CT-His-MBP-Lba_Cas13a_WT plasmid,p2CT-His-MBP-Lba_Cas13a_WT map,p2CT-His-MBP-Lba_Cas13a_WT sequence
Plasmid form: Freeze-dried powder
Storage Condition: -20 Centigrade
Bulk order Please contact us: sales@lifescience-market.com
Promoter: inquiry
Bacterial Resistance(s): Amp
Screening: inquiry
Growth Strain(s): Stbl3
Culture Medium: LB
Temperature: 37 Centigrade
Vector Size: 10267bp

 

p2CT-His-MBP-Lba_Cas13a_WT Sequence

ACGGGTGCGCATAGAAATTGCATCAACGCATATAGCGCTAGCAGCACGCCATAGTGACTGGCGATGCTGTCGGAATGGAC
GATATCCCGCAAGAGGCCCGGCAGTACCGGCATAACCAAGCCTATGCCTACAGCATCCAGGGTGACGGTGCCGAGGATGA
CGATGAGCGCATTGTTAGATTTCATACACGGTGCCTGACTGCGTTAGCAATTTAACTGTGATAAACTACCGCATTAAAGC
TTATCGATGATAAGCTGTCAAACATGAGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATG
TCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTC
TAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAACATTGAAAAAGGAAGAGTAT
GAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGC
TGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATC
CTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCG
TGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAG
AAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAAC
TTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGA
TCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGT
TGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTT
GCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCG
CGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTA
TGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCA
TATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGAC
CAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTT
TTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTA
CCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGG
CCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCG
ATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCG
TGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCT
TCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGG
GAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGG
GGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAA
CGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAACAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGT
ATTTCACACCGCAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGC
TACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCA
TCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAG
GCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGA
GTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGAT
GCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTAC
TGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAA
TCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAG
ATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGT
TGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAG
TAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGCCAGGACCCAACGCTG
CCCGAGATGCGCCGCGTGCGGCTGCTGGAGATGGCGGACGCGATGGATATGTTCTGCCAAGGGTTGGTTTGCGCATTCAC
AGTTCTCCGCAAGAATTGATTGGCTCCAATTCTTGGAGTGGTGAATCCGTTAGCGAGGTGCCGCCGGCTTCCATTCAGGT
CGAGGTGGCCCGGCTCCATGCACCGCGACGCAACGCGGGGAGGCAGACAAGGTATAGGGCGGCGCCTACAATCCATGCCA
ACCCGTTCCATGTGCTCGCCGAGGCGGCATAAATCGCCGTGACGATCAGCGGTCCAATGATCGAAGTTAGGCTGGTAAGA
GCCGCGAGCGATCCTTGAAGCTGTCCCTGATGGTCGTCATCTACCTGCCTGGACAGCATGGCCTGCAACGCGGGCATCCC
GATGCCGCCGGAAGCGAGAAGAATCATAATGGGGAAGGCCATCCAGCCTCGCGTCGCGAACGCCAGCAAGACGTAGCCCA
GCGCGTCGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGA
GCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAA
AATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCA
TGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGACGCTCTCCCTTATGCGACTCC
TGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGATGGC
GCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCC
GATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGT
CCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGT
GCCGGCTCCGGAGAGCTCTTTAATTAAGCGGCCGCCCTGCAGGACTCGAGTTCTAGAAATAATTTTGTTTAACTTTAAGA
AGGAGATATACATATGAAATCTTCTCACCATCACCATCACCATGGTTCTTCTATGAAAATCGAAGAAGGTAAACTGGTAA
TCTGGATTAACGGCGATAAAGGCTATAACGGTCTCGCTGAAGTCGGTAAGAAATTCGAGAAAGATACCGGAATTAAAGTC
ACCGTTGAGCATCCGGATAAACTGGAAGAGAAATTCCCACAGGTTGCGGCAACTGGCGATGGCCCTGACATTATCTTCTG
GGCACACGACCGCTTTGGTGGCTACGCTCAATCTGGCCTGTTGGCTGAAATCACCCCGGACAAAGCGTTCCAGGACAAGC
TGTATCCGTTTACCTGGGATGCCGTACGTTACAACGGCAAGCTGATTGCTTACCCGATCGCTGTTGAAGCGTTATCGCTG
ATTTATAACAAAGATCTGCTGCCGAACCCGCCAAAAACCTGGGAAGAGATCCCGGCGCTGGATAAAGAACTGAAAGCGAA
AGGTAAGAGCGCGCTGATGTTCAACCTGCAAGAACCGTACTTCACCTGGCCGCTGATTGCTGCTGACGGGGGTTATGCGT
TCAAGTATGAAAACGGCAAGTACGACATTAAAGACGTGGGCGTGGATAACGCTGGCGCGAAAGCGGGTCTGACCTTCCTG
GTTGACCTGATTAAAAACAAACACATGAATGCAGACACCGATTACTCCATCGCAGAAGCTGCCTTTAATAAAGGCGAAAC
AGCGATGACCATCAACGGCCCGTGGGCATGGTCCAACATCGACACCAGCAAAGTGAATTATGGTGTAACGGTACTGCCGA
CCTTCAAGGGTCAACCATCCAAACCGTTCGTTGGCGTGCTGAGCGCAGGTATTAACGCCGCCAGTCCGAACAAAGAGCTG
GCAAAAGAGTTCCTCGAAAACTATCTGCTGACTGATGAAGGTCTGGAAGCGGTTAATAAAGACAAACCGCTGGGTGCCGT
AGCGCTGAAGTCTTACGAGGAAGAGTTGGCGAAAGATCCACGTATTGCCGCCACTATGGAAAACGCCCAGAAAGGTGAAA
TCATGCCGAACATCCCGCAGATGTCCGCTTTCTGGTATGCCGTGCGTACTGCGGTGATCAACGCCGCCAGCGGTCGTCAG
ACTGTCGATGAAGCCCTGAAAGACGCGCAGACTAATTCGAGCTCGAACAACAACAACAATAACAATAACAACAACCTCGG
GATCGAGGAAAACCTGTACTTCCAATCCAATGCAATGAAGATCAGTAAAGTACGCGAAGAAAACCGTGGGGCCAAATTGA
CTGTGAACGCCAAGACTGCTGTAGTGTCCGAGAACCGTTCGCAAGAAGGGATCCTGTATAATGACCCAAGTCGTTACGGT
AAAAGCCGCAAAAATGACGAGGATCGTGACCGCTACATCGAGTCCCGTCTTAAGTCTTCTGGGAAATTATACCGCATTTT
TAATGAGGACAAGAACAAACGCGAGACAGACGAACTGCAATGGTTCCTTAGTGAGATCGTGAAGAAGATCAATCGTCGCA
ATGGTTTGGTATTATCGGATATGCTTAGTGTGGACGACCGCGCATTCGAGAAAGCCTTCGAAAAGTATGCAGAGTTATCG
TATACGAATCGCCGTAATAAAGTTTCTGGTAGCCCGGCGTTCGAGACCTGCGGAGTAGATGCAGCAACAGCTGAACGTTT
AAAAGGCATTATCTCGGAAACCAACTTTATCAACCGTATCAAAAACAATATCGACAACAAAGTCTCGGAGGACATTATCG
ATCGTATTATCGCTAAGTACTTGAAGAAAAGCTTGTGTCGTGAGCGTGTCAAACGTGGGTTAAAGAAACTTTTAATGAAT
GCCTTCGACTTGCCTTACAGTGACCCTGACATCGATGTGCAACGCGATTTTATTGATTACGTTTTAGAGGATTTCTACCA
TGTTCGTGCCAAGTCACAAGTGTCTCGTTCGATCAAAAACATGAATATGCCGGTGCAGCCCGAAGGCGATGGTAAGTTTG
CGATCACAGTAAGTAAGGGTGGGACGGAATCGGGGAACAAACGCTCTGCCGAAAAAGAAGCATTCAAAAAGTTCCTGAGT
GATTACGCGTCGCTGGATGAACGTGTTCGTGACGACATGCTTCGTCGCATGCGCCGCCTGGTCGTCTTGTACTTTTACGG
ATCAGACGATAGCAAATTATCAGATGTTAACGAAAAATTCGACGTATGGGAGGACCATGCTGCCCGCCGCGTAGACAATC
GCGAGTTCATCAAGCTTCCGTTGGAGAATAAACTTGCCAACGGCAAGACCGATAAAGATGCGGAACGTATCCGTAAGAAC
ACCGTTAAAGAACTGTATCGTAACCAAAATATTGGATGCTATCGCCAGGCTGTTAAAGCCGTAGAGGAGGACAACAACGG
TCGCTACTTCGACGACAAGATGCTGAACATGTTCTTTATTCACCGCATCGAGTACGGTGTGGAAAAGATTTACGCCAATT
TGAAACAAGTCACGGAGTTCAAGGCCCGCACTGGGTATCTTTCAGAGAAAATCTGGAAAGACTTGATCAATTACATTTCC
ATTAAATACATCGCTATGGGCAAGGCAGTCTACAATTACGCCATGGATGAGCTGAATGCCTCAGACAAAAAGGAGATCGA
GCTGGGCAAGATCAGTGAAGAATATTTGTCCGGGATCAGTTCGTTTGACTATGAATTGATCAAAGCCGAAGAGATGCTGC
AACGCGAGACCGCTGTATATGTTGCTTTCGCGGCTCGCCACTTGTCCTCCCAGACCGTTGAACTGGATTCCGAGAACTCC
GACTTCCTTCTTTTGAAGCCAAAGGGAACTATGGACAAGAACGATAAAAACAAGTTAGCCTCCAACAACATTCTTAATTT
TCTTAAGGACAAGGAAACACTTCGCGATACCATTTTACAGTACTTTGGCGGCCACAGTCTGTGGACCGACTTTCCGTTTG
ACAAATACTTGGCCGGCGGGAAAGACGACGTCGACTTCCTGACAGACCTTAAAGATGTGATTTACTCCATGCGTAATGAT
AGTTTTCACTATGCTACTGAAAACCACAACAATGGAAAATGGAATAAGGAATTAATTAGTGCAATGTTTGAACATGAAAC
AGAGCGTATGACAGTAGTCATGAAAGATAAATTCTACTCGAATAATCTTCCTATGTTCTATAAGAATGACGACTTGAAGA
AATTGCTGATCGATTTGTACAAGGATAACGTAGAGCGTGCGAGCCAGGTCCCATCTTTTAACAAGGTCTTCGTGCGCAAG
AATTTTCCTGCTTTGGTTCGCGATAAAGACAACTTGGGGATTGAATTAGACCTTAAGGCGGACGCGGATAAAGGTGAGAA
CGAGTTAAAATTCTACAACGCTCTTTATTACATGTTTAAAGAGATCTACTATAACGCGTTCTTAAATGATAAGAATGTGC
GTGAACGTTTTATTACTAAGGCGACGAAAGTGGCCGATAACTATGATCGCAATAAGGAGCGCAACCTTAAAGACCGTATT
AAGTCCGCGGGGTCGGATGAGAAAAAAAAGTTACGTGAACAGCTGCAGAATTACATTGCTGAGAATGACTTCGGGCAGCG
TATCAAGAATATCGTGCAGGTCAATCCGGATTATACCCTGGCTCAAATCTGCCAACTTATTATGACGGAGTATAATCAAC
AAAACAACGGGTGCATGCAGAAAAAGTCTGCTGCCCGCAAAGACATCAATAAGGATAGTTACCAGCATTACAAGATGCTG
CTTTTGGTTAATTTACGCAAAGCATTTTTGGAATTTATTAAGGAGAATTATGCTTTTGTTTTGAAACCCTATAAACACGA
CCTTTGTGATAAAGCCGATTTCGTGCCAGATTTCGCCAAATACGTCAAACCCTACGCTGGCTTGATCAGCCGTGTAGCAG
GATCAAGTGAGCTGCAAAAGTGGTACATCGTGAGCCGCTTCTTGTCTCCGGCACAGGCCAATCACATGCTTGGGTTCCTG
CACTCGTACAAGCAGTACGTATGGGATATTTACCGCCGCGCATCCGAAACCGGTACAGAGATTAACCACTCTATCGCAGA
GGACAAGATTGCTGGGGTTGACATTACCGACGTCGACGCAGTGATCGATTTATCGGTGAAATTGTGCGGAACAATCTCTA
GCGAGATTTCGGATTATTTCAAGGATGACGAGGTCTACGCGGAGTACATCTCATCATATTTAGATTTCGAATACGATGGT
GGTAATTACAAAGACTCGCTGAACCGTTTCTGTAATTCAGACGCAGTAAATGACCAAAAAGTGGCACTGTATTATGACGG
CGAACACCCGAAATTGAATCGTAACATTATCTTGTCGAAACTTTACGGAGAGCGCCGTTTCTTGGAGAAAATCACTGACC
GCGTTTCTCGTTCAGATATTGTGGAGTATTACAAGCTGAAGAAGGAGACGTCGCAGTATCAGACGAAAGGGATTTTCGAT
AGTGAGGACGAACAGAAGAATATTAAGAAGTTTCAGGAGATGAAAAACATCGTGGAATTTCGTGATCTGATGGATTACTC
GGAGATCGCGGACGAATTACAAGGACAACTGATCAACTGGATTTATCTTCGTGAACGTGACCTGATGAACTTCCAACTGG
GGTATCATTACGCCTGCTTGAACAACGACTCAAATAAGCAAGCTACTTATGTAACTCTTGATTACCAAGGTAAAAAAAAC
CGCAAGATTAACGGTGCGATTTTATATCAGATTTGTGCAATGTATATTAATGGACTGCCGCTTTACTACGTCGATAAAGA
CAGTTCGGAGTGGACGGTGAGCGACGGTAAGGAATCCACGGGAGCCAAGATTGGTGAATTCTACCGCTATGCAAAGTCCT
TTGAAAATACGTCTGACTGCTACGCTTCGGGCTTAGAGATCTTCGAGAATATCAGTGAGCACGACAACATCACGGAATTA
CGCAACTACATTGAACATTTTCGTTACTACAGCTCTTTTGACCGTTCCTTTTTGGGGATCTATTCAGAGGTGTTTGATCG
CTTTTTCACATACGACTTAAAGTATCGCAAAAACGTACCTACCATCTTGTATAATATTTTACTGCAACACTTTGTTAATG
TCCGCTTCGAGTTCGTAAGCGGCAAAAAAATGATTGGCATTGACAAAAAGGACCGCAAGATTGCCAAAGAGAAGGAATGC
GCTCGTATTACAATCCGCGAAAAGAACGGTGTCTACTCGGAGCAGTTCACTTACAAGTTGAAGAATGGGACCGTGTATGT
CGATGCGCGTGACAAACGCTACCTGCAGTCCATTATTCGTCTTTTGTTTTACCCCGAAAAGGTCAACATGGACGAAATGA
TCGAAGTTAAGGAAAAGAAGAAGCCGAGTGACAATAATACGGGAAAGGGCTATAGCAAACGCGACCGCCAGCAGGATCGT
AAAGAATATGACAAGTACAAAGAAAAAAAGAAAAAGGAGGGGAATTTCCTTTCAGGTATGGGAGGCAATATCAACTGGGA
CGAGATTAACGCTCAACTTAAGAACTAGTAAATTGGAAGTGGATAACGGATCCGCGATCGTGGCGCGCCACCTGGTGGCC
GGCCGGTACCACGCGTGCGCGCTGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAG
CAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATA
TCCACAGGACGGGTGTGGTCGCCATGATCGCGTAGTCGATAGTGGCTCCAAGTAGCGAAGCGAGCAGGACTGGGCGGCGG
CCAAAGCGGTCGGACAGTGCTCCGAGA
//

 

p2CT-His-MBP-Lba_Cas13a_WT Map

p2CT-His-MBP-Lba_Cas13a_WT map

*Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart