p3xFLAG- CMV- 14


  • Model: PVT1046
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1046    2ug


p3xFLAG-CMV-14 Information

Promoter: CMV

Replicon: pUC

Terminator: SV40 poly (a) signal, hGH poly (a) signal

Plasmid classification: mammalian cells, protein overexpression vector

Plasmid size: 6310bp

Prokaryotic resistance: Amp

Eukaryotic resistance: G418

Clone strain: DH5a

Culture conditions: 37℃

Expression host: Mammalian cells

Induction mode: transient expression without induction

5 'sequencing primer: cmv-f: cgcaaaatgggcgtgtgtgggtgggtg

3 'sequencing primer: hgh-pa-r: ccagttgtcccaataga

Plasmid host: mammalian cells

Purpose of plasmid: protein expression

Fragment type: ORF

Fragment species: empty bodies

Prokaryotic resistance: Amp

Eukaryotic resistance: G418


p3xFLAG-CMV-14 Description

p3xFLAG-CMV-14 vector is a 6.3 KB carrier derived from the pCMV5 vector, which is used for transient expression in mammalian cells or the stable expression of C terminal with 3xFlag tag fusion protein. Three adjacent Flag epitopes (Asp-Tyr-Lys-Xaa-Xaa-Asp) were encoded by the downstream fragment of the vector. This makes it possible to detect protein expression using M2 Flag antibody.



p3xFLAG-CMV-14 Sequence

LOCUS       Exported                6310 bp ds-DNA     circular SYN 29-AUG-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 12

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 6310)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, August 29, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..6310

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     primer_bind     141..157

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     enhancer        318..697

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        698..901

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     CDS             993..1058


                     /product="three tandem FLAG(R) epitope tags, followed by an

                     enterokinase cleavage site"



     polyA_signal    1069..1691

                     /note="hGH poly(A) signal"

                     /note="human growth hormone polyadenylation signal"

     promoter        1733..2030

                     /note="SV40 promoter"

                     /note="SV40 enhancer and early promoter"

     CDS             2084..2878


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"


                     /note="confers resistance to neomycin, kanamycin, and G418 







     polyA_signal    3530..3664

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     promoter        complement(3670..3688)

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     primer_bind     complement(3702..3718)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    3726..3742

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(3750..3780)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    3795..3816

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     rep_origin      complement(4104..4692)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(4863..5723)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(5724..5828)


                     /note="AmpR promoter"

     rep_origin      5855..6310


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"


        1 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct

       61 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg

      121 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa

      181 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta

      241 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc

      301 aatatgaccg ccatgttgac attgattatt gactagttat taatagtaat caattacggg

      361 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc

      421 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat

      481 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc

      541 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga

      601 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg

      661 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac

      721 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt

      781 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc

      841 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc

      901 tcgtttagtg aaccgtcaga attaagcttg cggccgcgaa ttcatcgata gatctgatat

      961 cggtaccagt cgactctaga ggatcccggg ctgactacaa agaccatgac ggtgattata

     1021 aagatcatga catcgactac aaggatgacg atgacaagta gtgatcccgg gtggcatccc

     1081 tgtgacccct ccccagtgcc tctcctggcc ctggaagttg ccactccagt gcccaccagc

     1141 cttgtcctaa taaaattaag ttgcatcatt ttgtctgact aggtgtcctt ctataatatt

     1201 atggggtgga ggggggtggt atggagcaag gggcaagttg ggaagacaac ctgtagggcc

     1261 tgcggggtct attgggaacc aagctggagt gcagtggcac aatcttggct cactgcaatc

     1321 tccgcctcct gggttcaagc gattctcctg cctcagcctc ccgagttgtt gggattccag

     1381 gcatgcatga ccaggctcag ctaatttttg tttttttggt agagacgggg tttcaccata

     1441 ttggccaggc tggtctccaa ctcctaatct caggtgatct acccaccttg gcctcccaaa

     1501 ttgctgggat tacaggcgtg aaccactgct cccttccctg tccttctgat tttaaaataa

     1561 ctataccagc aggaggacgt ccagacacag cataggctac ctggccatgc ccaaccggtg

     1621 ggacatttga gttgcttgct tggcactgtc ctctcatgcg ttgggtccac tcagtagatg

     1681 cctgttgaat tgggtacgcg gccagcttgg ctgtggaatg tgtgtcagtt agggtgtgga

     1741 aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca

     1801 accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc

     1861 aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc

     1921 agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag

     1981 gccgcctcgg cctctgagct attccagaag tagtgaggag gcttttttgg aggaattgat

     2041 cagcttggga tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg

     2101 attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca

     2161 acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt

     2221 tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg

     2281 gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga

     2341 agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca

     2401 ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct

     2461 tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac

     2521 tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc

     2581 gccagccgaa ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg atctcgtcgt

     2641 gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt

     2701 catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg

     2761 tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat

     2821 cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc

     2881 gggactctgg ggttcgaaat gaccgaccaa gcgacgccca acctgccatc acgagatttc

     2941 gattccaccg ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc

     3001 tggatgatcc tccagcgcgg ggatctcatg ctggagttct tcgcccaccc cgggctcgat

     3061 cccctcgcga gttggttcag ctgctgcctg aggctggacg acctcgcgga gttctaccgg

     3121 cagtgcaaat ccgtcggcat ccaggaaacc agcagcggct atccgcgcat ccatgccccc

     3181 gaactgcagg agtggggagg cacgatggcc gctttggtcg acccggacgg gacgctcctg

     3241 cgcctgatac agaacgaatt gcttgcaggc atctcatgag tgtgtcttcc cgttttccgc

     3301 ctgaggtcac tgcgtggatg gagcgctggc gcctgctgcg cgacggcgag ctgctcacca

     3361 cccactcgcc aagctggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc

     3421 gccgatcata atcagccata ccacatttgt agaggtttta cttgctttaa aaaacctccc

     3481 acacctcccc ctgaacctga aacataaaat gaatgcaatt gttgttgtta acttgtttat

     3541 tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa ataaagcatt

     3601 tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatgtctg

     3661 gatcaattcc ctatagtgag tcgtattaaa ttcgtaatca tgtcatagct gtttcctgtg

     3721 tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa

     3781 gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct

     3841 ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga

     3901 ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc

     3961 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa

     4021 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt

     4081 aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa

     4141 aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt

     4201 ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg

     4261 tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc

     4321 agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc

     4381 gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta

     4441 tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct

     4501 acagagttct tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc

     4561 tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa

     4621 caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa

     4681 aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa

     4741 aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt

     4801 ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac

     4861 agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc

     4921 atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc

     4981 cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata

     5041 aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc

     5101 cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc

     5161 aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca

     5221 ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa

     5281 gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca

     5341 ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt

     5401 tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt

     5461 tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg

     5521 ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga

     5581 tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc

     5641 agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg

     5701 acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag

     5761 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg

     5821 gttccgcgca catttccccg aaaagtgcca cctgacgcgc cctgtagcgg cgcattaagc

     5881 gcggcgggtg tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc

     5941 gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct

     6001 ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa

     6061 aaacttgatt agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc

     6121 cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca

     6181 ctcaacccta tctcggtcta ttcttttgat ttataaggga ttttgccgat ttcggcctat

     6241 tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg

     6301 cttacaattt



Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
