p3xFLAG- CMV- 7.1

  • Model: PVT1044
  • 0 Units in Stock
Ask a question

 Sold Out 


PVT1044      2ug


p3xFLAG-CMV-7.1 Information

Promoter: CMV, SV40, T7

Replicator: F1 ori SV40 ori pUCori

Terminator: SV40 poly (A) signal, hGH poly (A) signal

Plasmid classification: mammalian cells, protein overexpression vectors

Plasmid size: 4717bp

Prokaryotic resistance: Amp

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression


3'sequencing primers: hGH-PA-R:CCAGCTTGGTTCCCAATAGA 


p3xFLAG-CMV-7.1 Description

p3XFLAG-CMV-7.1 Expression Vector is a 4.7 kb derivative of pCMV5 used to establish transient intracellular expression of N-terminal 3XFLAG fusion proteins in mammalian cells. The vector encodes three adjacent FLAG epitopes (Asp-Tyr-Lys-Xaa-Xaa-Asp) upstream of the multiple cloning region. This results in increased detection sensitivity using ANTI-FLAG M2 antibody. The third FLAG epitope includes the enterokinase recognition sequence, allowing cleavage of the 3XFLAG peptide from the purified fusion protein.



p3xFLAG-CMV-7.1 Sequence

LOCUS       Exported                4717 bp ds-DNA     circular SYN 29-AUG-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 3

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4717)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, August 29, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..4717

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     primer_bind     141..157

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     enhancer        318..697

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        698..901

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     CDS             931..996


                     /product="three tandem FLAG(R) epitope tags, followed by an

                     enterokinase cleavage site"



     polyA_signal    1058..1680

                     /note="hGH poly(A) signal"

                     /note="human growth hormone polyadenylation signal"

     promoter        1709..2038

                     /note="SV40 promoter"

                     /note="SV40 enhancer and early promoter"

     rep_origin      1889..2024

                     /note="SV40 ori"

                     /note="SV40 origin of replication"

     promoter        complement(2077..2095)

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     primer_bind     complement(2109..2125)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    2133..2149

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(2157..2187)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    2202..2223

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     rep_origin      complement(2511..3099)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(3270..4130)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(4131..4235)


                     /note="AmpR promoter"

     rep_origin      4262..4717


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"


        1 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct

       61 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg

      121 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa

      181 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta

      241 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc

      301 aatatgaccg ccatgttgac attgattatt gactagttat taatagtaat caattacggg

      361 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc

      421 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat

      481 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc

      541 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga

      601 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg

      661 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac

      721 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt

      781 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc

      841 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc

      901 tcgtttagtg aaccgtcaga attaaccatg gactacaaag accatgacgg tgattataaa

      961 gatcatgaca tcgattacaa ggatgacgat gacaagcttg cggccgcgaa ttcatcgata

     1021 gatctgatat cggtaccagt cgactctaga ggatcccggg tggcatccct gtgacccctc

     1081 cccagtgcct ctcctggccc tggaagttgc cactccagtg cccaccagcc ttgtcctaat

     1141 aaaattaagt tgcatcattt tgtctgacta ggtgtccttc tataatatta tggggtggag

     1201 gggggtggta tggagcaagg ggcaagttgg gaagacaacc tgtagggcct gcggggtcta

     1261 ttgggaacca agctggagtg cagtggcaca atcttggctc actgcaatct ccgcctcctg

     1321 ggttcaagcg attctcctgc ctcagcctcc cgagttgttg ggattccagg catgcatgac

     1381 caggctcagc taatttttgt ttttttggta gagacggggt ttcaccatat tggccaggct

     1441 ggtctccaac tcctaatctc aggtgatcta cccaccttgg cctcccaaat tgctgggatt

     1501 acaggcgtga accactgctc ccttccctgt ccttctgatt ttaaaataac tataccagca

     1561 ggaggacgtc cagacacagc ataggctacc tggccatgcc caaccggtgg gacatttgag

     1621 ttgcttgctt ggcactgtcc tctcatgcgt tgggtccact cagtagatgc ctgttgaatt

     1681 gggtacgcgg ccagcttggc tgtggaatgt gtgtcagtta gggtgtggaa agtccccagg

     1741 ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg

     1801 aaagtcccca ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc

     1861 aaccatagtc ccgcccctaa ctccgcccat cccgccccta actccgccca gttccgccca

     1921 ttctccgccc catggctgac taattttttt tatttatgca gaggccgagg ccgcctcggc

     1981 ctctgagcta ttccagaagt agtgaggagg cttttttgga ggcctaggct tttgcaaaaa

     2041 gctcctcgag gaactgaaaa accagaaagt taattcccta tagtgagtcg tattaaattc

     2101 gtaatcatgt catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac

     2161 atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca

     2221 ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat

     2281 taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc

     2341 tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca

     2401 aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca

     2461 aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg

     2521 ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg

     2581 acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt

     2641 ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt

     2701 tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc

     2761 tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt

     2821 gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt

     2881 agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc

     2941 tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa

     3001 agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt

     3061 tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct

     3121 acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta

     3181 tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa

     3241 agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc

     3301 tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact

     3361 acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc

     3421 tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt

     3481 ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta

     3541 agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg

     3601 tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt

     3661 acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc

     3721 agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt

     3781 actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc

     3841 tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc

     3901 gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa

     3961 ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac

     4021 tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa

     4081 aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt

     4141 tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa

     4201 tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct

     4261 gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc

     4321 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc

     4381 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt

     4441 agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg

     4501 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt

     4561 ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta

     4621 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt

     4681 aacgcgaatt ttaacaaaat attaacgctt acaattt



Search name

p3xFLAG-CMV-7.1,Plasmid p3xFLAG-CMV-7.1,p3xFLAG-CMV-7.1 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
