p3xFLAG- CMV- 7.1 Plasmid

  • Model: PVT1044
  • 0 Units in Stock
Ask a question

 Sold Out 


Search name

p3xFLAG-CMV-7.1,Plasmid p3xFLAG-CMV-7.1,p3xFLAG-CMV-7.1 vector


p3xFLAG-CMV-7.1 Information

Promoter: CMV, SV40, T7

Replicator: F1 ori SV40 ori pUCori

Terminator: SV40 poly (A) signal, hGH poly (A) signal

Plasmid classification: mammalian cells, protein overexpression vectors

Plasmid size: 4717bp

Prokaryotic resistance: Amp

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression


3'sequencing primers: hGH-PA-R:CCAGCTTGGTTCCCAATAGA 


p3xFLAG-CMV-7.1 Description

p3XFLAG-CMV-7.1 Expression Vector is a 4.7 kb derivative of pCMV5 used to establish transient intracellular expression of N-terminal 3XFLAG fusion proteins in mammalian cells. The vector encodes three adjacent FLAG epitopes (Asp-Tyr-Lys-Xaa-Xaa-Asp) upstream of the multiple cloning region. This results in increased detection sensitivity using ANTI-FLAG M2 antibody. The third FLAG epitope includes the enterokinase recognition sequence, allowing cleavage of the 3XFLAG peptide from the purified fusion protein.



p3xFLAG-CMV-7.1 Sequence

LOCUS       Exported                4717 bp ds-DNA     circular SYN 29-AUG-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4717)
  TITLE     Direct Submission
  JOURNAL   Exported Monday, August 29, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4717
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     primer_bind     141..157
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar 
     enhancer        318..697
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        698..901
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     CDS             931..996
                     /product="three tandem FLAG(R) epitope tags, followed by an
                     enterokinase cleavage site"
     polyA_signal    1058..1680
                     /note="hGH poly(A) signal"
                     /note="human growth hormone polyadenylation signal"
     promoter        1709..2038
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      1889..2024
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(2077..2095)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(2109..2125)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     protein_bind    2133..2149
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2157..2187)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    2202..2223
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     rep_origin      complement(2511..3099)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(3270..4130)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4131..4235)
                     /note="AmpR promoter"
     rep_origin      4262..4717
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
        1 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct
       61 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg
      121 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa
      181 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta
      241 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc
      301 aatatgaccg ccatgttgac attgattatt gactagttat taatagtaat caattacggg
      361 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc
      421 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat
      481 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc
      541 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga
      601 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg
      661 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
