

  • Model: PVT11243
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11243
Packing 2ug


p426gal Information

Function yeast expression plasmid

Promoters: URA3, T7, T3, GAL1

Replicator: 2 ori, ori, FI ori

Terminator: CYC1

Plasmid classification: yeast series, Saccharomyces cerevisiae expression vector

Plasmid size: 6412bp

Prokaryotic resistance: Amp

Screening markers: URA3

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Induction method: galactose induction

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: primers designed according to sequence


p426gal Multiple site/ map



p426gal Sequence

LOCUS       Exported                6412 bp ds-DNA     circular SYN 12-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 9
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6412)
  TITLE     Direct Submission
  JOURNAL   Exported Monday, September 12, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..6412
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        201..416
                     /gene="S. cerevisiae URA3"
                     /note="URA3 promoter"
     CDS             417..1220
                     /gene="S. cerevisiae URA3"
                     /product="orotidine-5'-phosphate decarboxylase, required 
                     for uracil biosynthesis"
                     /note="yeast auxotrophic marker, counterselectable with 
                     5-fluoroorotic acid (5-FOA)"
     rep_origin      complement(1351..1806)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     primer_bind     1951..1967
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar 
     promoter        1977..1995
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     terminator      2014..2261
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     primer_bind     2264..2280
                     /note="KS primer"
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(2314..2330)
                     /note="SK primer"
                     /note="common sequencing primer, one of multiple similar 
     promoter        complement(2345..2786)
                     /gene="S. cerevisiae GAL1"
                     /note="GAL1 promoter"
                     /note="inducible promoter, regulated by Gal4"
     protein_bind    2669..2786
                     /note="upstream activating sequence mediating 
                     Gal4-dependent induction"
     promoter        complement(2810..2828)
                     /note="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     primer_bind     complement(2849..2865)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     protein_bind    2873..2889
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2897..2927)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     rep_origin      complement(3251..3839)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(4010..4870)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4871..4975)
                     /note="AmpR promoter"
     rep_origin      5002..6344
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
