p53- ABAI

$162.00

  • Model: PVT4023
  • 50 Units in Stock
Ask a question


Add to Cart:

p53-ABAI

PVT4023      2ug

 

p53-ABAI Information

Promoter: URA3
Replicon: pUC ori
Plasmid classification: yeast series plasmids; yeast hybrid plasmids; single hybrid plasmids
Plasmid size: 4944bp
Prokaryotic resistance: ampicillin Amp (100 u g/ml)
Screening markers: URA3
Cloned strains of Escherichia coli, DH5 A and other Escherichia coli
Culture conditions: 37 centigrade, aerobic LB
Expression host: Y1Hgold and other yeast
Culture conditions: 30 centigrade, YPDA, aerobic
5'sequencing primers: pABAI-F (GTTCCTTATATGTAGCTTTCGACA)
3'sequencing primers: pABAI-R (CCATCTCGAAAAAGGGTTTGCC)
Remarks: low copy plasmids
Use: Yeast expression

 

p53-ABAI Description

p53-ABAI  is a single hybrid yeast positive control plasmid. The plasmid has AbA resistance and thus has a strong screening ability, which can greatly reduce the background level.

p53-AbAi is a yeast reporter vector that serves as a positive control in the Matchmaker Gold Yeast One-Hybrid Library Screening System. The vector contains a p53 binding site, located upstream of the yeast iso-1-cytochrome C minimal promoter and the AUR1-C gene, an antibiotic resistance gene that confers resistance to Aureobasidin A. Expression of AUR1-C, and thus AbA resistance, is induced by the binding of GAL4 activation domain-p53 fusion proteins to the p53 binding site upstream of AUR1-C.
      p53-AbAi cannot be propagated episomally in yeast; it can only be stably maintained through integration into the host genome. Integration is accomplished via homologous recombination between the vector’s URA3 gene and the nonfunctional ura3-52 locus of the yeast strain provided in the Matchmaker Gold Yeast One-Hybrid System. URA3 is a nutritional marker that can also be used for the selection of recombinant yeast. To allow propagation and selection in E. coli, the vector also contains a Col E1 origin of replication and an ampicillin resistance gene (Ampr).
     p53-AbAi is a positive control reporter vector that is designed to be used in conjunction with the autonomously replicating pGADT7-Rec vector and the p53 control cDNA provided in the Matchmaker Gold Yeast One-Hybrid Library Screening System. To perform control reactions, first linearize the p53-AbAi vector with BstBI, transform the vector into competent yeast cells, and select for integrants on SD/–Ura medium. Next, cotransform the p53 control cDNA and the SmaI-linearized pGADT7-Rec vector (provided) into competent yeast cells, and select for recombinants on SD/–Leu medium containing AbA (see the protocol in the Matchmaker Gold Yeast One-Hybrid Library Screening System User Manual  for details).
     Transformation of yeast with the linearized p53-AbAi vector will result in the integration of the vector into the yeast chromosome. Subsequent cotransformation of the linearized pGADT7-Rec vector and the p53 control cDNA will yield a construct, through the gap-repair method,that will constitutively express a GAL4 AD-p53 fusion protein. GAL4 AD-p53 will interact with the p53 binding sites on p53-AbAi and stimulate transcription of AUR1-C.
       •    Suitable host strains: DH5α and other general purpose strains.
       •    Selectable marker: plasmid confers resistance to ampicillin (100 µg/ml) to E. coli hosts.
       •    E. coli replication origin: ColE1
       •    Copy number: low

p53-ABAI-polyclonal-site

 

p53-ABAI Sequence

LOCUS       Exported                4944 bp ds-DNA     circular SYN 10-SEP-2016

DEFINITION  synthetic circular DNA

KEYWORDS    p53-AbAi

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4944)

  TITLE     Direct Submission

  JOURNAL   Exported Saturday, September 10, 2016

COMMENT     Created by Clontech Laboratories Inc. http://www.clontech.com

            Cat. No. 630491

FEATURES             Location/Qualifiers

     source          1..4944

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        25..83

                     /note="p53 binding site"

     misc_feature    235..1440

                     /note="Aur1-C"

                     /note="Aureobasidin Resistance"

     rep_origin      2209..2659

                     /note="pUC origin"

     misc_feature    complement(2856..3716)

                     /note="Amp(R)"

     misc_feature    complement(3925..4727)

                     /note="URA3"

ORIGIN

        1 aagcttgaat tcgagctcgg taccaggcat gcctagcatg cctaggcatg cctaggcatg

       61 cctaggcatg cctaggcatg cctggatccc tcgaggcatg tgctctgtat gtatataaaa

      121 ctcttgtttt cttcttttct ctaaatattc tttccttata cattaggtcc tttgtagcat

      181 aaattactat acttctatag acacgcaaac acaaatacac acactaaatt aataatggca

      241 aacccttttt cgagatggtt tctatcagag agacctccaa actgccatgt agccgattta

      301 gaaacaagtt tagatcccca tcaaacgttg ttgaaggtgc aaaaatacaa acccgcttta

      361 agcgactggg tgcattacat cttcttggga tccatcatgc tgtttgtgtt cattactaat

      421 cccgcacctt ggatcttcaa gatccttttt tattgtttct tgggcacttt attcatcatt

      481 ccagctacgt cacagttttt cttcaatgcc ttgcccatcc taacatgggt ggcgctgtat

      541 ttcacttcat cgtactttcc agatgaccgc aggcctccta ttactgtcaa agtgttacca

      601 gcggtggaaa caattttata cggcgacaat ttaagtgata ttcttgcaac atcgacgaat

      661 tcctttttgg acattttagc atggttaccg tacggactat ttcattatgg ggccccattt

      721 gtcgttgctg ccatcttatt cgtatttggt ccaccaactg ttttgcaagg ttatgctttt

      781 gcatttggtt atatgaacct gtttggtgtt atcatgcaaa atgtctttcc agccgctccc

      841 ccatggtata aaattctcta tggattgcaa tcagccaact atgatatgca tggctcgcct

      901 ggtggattag ctagaattga taagctactc ggtattaata tgtatactac atgtttttca

      961 aattcctccg tcattttcgg tgcttttcct tcactgcatt ccgggtgtgc tactatggaa

     1021 gccctgtttt tctgttattg ttttccaaaa ttgaagccct tgtttattgc ttatgtttgc

     1081 tggttatggt ggtcaactat gtatctgaca caccattatt ttgtagacct tatggcaggt

     1141 tctgtgctgt catacgttat tttccagtac acaaagtaca cacatttacc aattgtagat

     1201 acatctcttt tttgcagatg gtcatacact tcaattgaga aatacgatat atcaaagagt

     1261 gatccattgg ctgcagattc aaacgatatc gaaagtgtcc ctttgtccaa cttggaactt

     1321 gactttgatc ttaatatgac tgatgaaccc agtgtaagcc cttcgttatt tgatggatct

     1381 acttctgttt ctcgttcgtc cgccacgtct ataacgtcac taggtgtaaa gagggcttaa

     1441 ggaaatccat tatgtactat ttaaaaaaca caaacttttg gatgttcggt ttattctttt

     1501 tcttttactt ttttatcatg ggagcctact tcccgttttt cccgatttgg ctacatgaca

     1561 tcaaccatat cagcaaaagt gatacgggta ttatttttgc cgctatttct ctgttctcgc

     1621 tattattcca accgctgttt ggtctgcttt ctgacaaact cggcctcgac tctagcgaat

     1681 taattcgtaa tcatgtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca

     1741 cacaacatac gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa

     1801 ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag

     1861 ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc

     1921 gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct

     1981 cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg

     2041 tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc

     2101 cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga

     2161 aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct

     2221 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg

     2281 gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag

     2341 ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat

     2401 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac

     2461 aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac

     2521 tacggctaca ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc

     2581 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt

     2641 tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc

     2701 ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg

     2761 agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca

     2821 atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca

     2881 cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag

     2941 ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac

     3001 ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc

     3061 agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct

     3121 agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc

     3181 gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg

     3241 cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc

     3301 gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat

     3361 tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag

     3421 tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aacacgggat

     3481 aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg

     3541 cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca

     3601 cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga

     3661 aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc

     3721 ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata

     3781 tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg

     3841 ccacctgggt aataactgat ataattaaat tgaagctcta atttgtgagt ttagtataca

     3901 tgcatttact tataatacag ttttttagtt ttgctggccg catcttctca aatatgcttc

     3961 ccagcctgct tttctgtaac gttcaccctc taccttagca tcccttccct ttgcaaatag

     4021 tcctcttcca acaataataa tgtcagatcc tgtagagacc acatcatcca cggttctata

     4081 ctgttgaccc aatgcgtctc ccttgtcatc taaacccaca ccgggtgtca taatcaacca

     4141 atcgtaacct tcatctcttc cacccatgtc tctttgagca ataaagccga taacaaaatc

     4201 tttgtcgctc ttcgcaatgt caacagtacc cttagtatat tctccagtag atagggagcc

     4261 cttgcatgac aattctgcta acatcaaaag gcctctaggt tcctttgtta cttcttctgc

     4321 cgcctgcttc aaaccgctaa caatacctgg gcccaccaca ccgtgtgcat tcgtaatgtc

     4381 tgcccattct gctattctgt atacacccgc agagtactgc aatttgactg tattaccaat

     4441 gtcagcaaat tttctgtctt cgaagagtaa aaaattgtac ttggcggata atgcctttag

     4501 cggcttaact gtgccctcca tggaaaaatc agtcaagata tccacatgtg tttttagtaa

     4561 acaaattttg ggacctaatg cttcaactaa ctccagtaat tccttggtgg tacgaacatc

     4621 caatgaagca cacaagtttg tttgcttttc gtgcatgata ttaaatagct tggcagcaac

     4681 aggactagga tgagtagcag cacgttcctt atatgtagct ttcgacatga tttatcttcg

     4741 tttcctgcag gtttttgttc tgtgcagttg ggttaagaat actgggcaat ttcatgtttc

     4801 ttcaacacta catatgcgta tatataccaa tctaagtctg tgctccttcc ttcgttcttc

     4861 cttctgttcg gagattaccg aatcaaaaaa atttcaagga aaccgaaatc aaaaaaaaga

     4921 ataaaaaaaa aatgatgaat tgaa

//

 

Search name

p53-ABAI,Plasmid p53-ABAI,p53-ABAI vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart