p53- ABAI Plasmid

$136.00

  • Model: PVT4023
  • 50 Units in Stock
Ask a question


Add to Cart:

p53-ABAI

Search name

p53-ABAI,Plasmid p53-ABAI,p53-ABAI vector

 

p53-ABAI Information

Promoter: URA3
Replicon: pUC ori
Plasmid classification: yeast series plasmids; yeast hybrid plasmids; single hybrid plasmids
Plasmid size: 4944bp
Prokaryotic resistance: ampicillin Amp (100 u g/ml)
Screening markers: URA3
Cloned strains of Escherichia coli, DH5 A and other Escherichia coli
Culture conditions: 37 centigrade, aerobic LB
Expression host: Y1Hgold and other yeast
Culture conditions: 30 centigrade, YPDA, aerobic
5'sequencing primers: pABAI-F (GTTCCTTATATGTAGCTTTCGACA)
3'sequencing primers: pABAI-R (CCATCTCGAAAAAGGGTTTGCC)
Remarks: low copy plasmids
Use: Yeast expression

 

p53-ABAI Description

p53-ABAI  is a single hybrid yeast positive control plasmid. The plasmid has AbA resistance and thus has a strong screening ability, which can greatly reduce the background level.

p53-AbAi is a yeast reporter vector that serves as a positive control in the Matchmaker Gold Yeast One-Hybrid Library Screening System. The vector contains a p53 binding site, located upstream of the yeast iso-1-cytochrome C minimal promoter and the AUR1-C gene, an antibiotic resistance gene that confers resistance to Aureobasidin A. Expression of AUR1-C, and thus AbA resistance, is induced by the binding of GAL4 activation domain-p53 fusion proteins to the p53 binding site upstream of AUR1-C.
      p53-AbAi cannot be propagated episomally in yeast; it can only be stably maintained through integration into the host genome. Integration is accomplished via homologous recombination between the vector’s URA3 gene and the nonfunctional ura3-52 locus of the yeast strain provided in the Matchmaker Gold Yeast One-Hybrid System. URA3 is a nutritional marker that can also be used for the selection of recombinant yeast. To allow propagation and selection in E. coli, the vector also contains a Col E1 origin of replication and an ampicillin resistance gene (Ampr).
     p53-AbAi is a positive control reporter vector that is designed to be used in conjunction with the autonomously replicating pGADT7-Rec vector and the p53 control cDNA provided in the Matchmaker Gold Yeast One-Hybrid Library Screening System. To perform control reactions, first linearize the p53-AbAi vector with BstBI, transform the vector into competent yeast cells, and select for integrants on SD/–Ura medium. Next, cotransform the p53 control cDNA and the SmaI-linearized pGADT7-Rec vector (provided) into competent yeast cells, and select for recombinants on SD/–Leu medium containing AbA (see the protocol in the Matchmaker Gold Yeast One-Hybrid Library Screening System User Manual  for details).
     Transformation of yeast with the linearized p53-AbAi vector will result in the integration of the vector into the yeast chromosome. Subsequent cotransformation of the linearized pGADT7-Rec vector and the p53 control cDNA will yield a construct, through the gap-repair method,that will constitutively express a GAL4 AD-p53 fusion protein. GAL4 AD-p53 will interact with the p53 binding sites on p53-AbAi and stimulate transcription of AUR1-C.
       •    Suitable host strains: DH5α and other general purpose strains.
       •    Selectable marker: plasmid confers resistance to ampicillin (100 µg/ml) to E. coli hosts.
       •    E. coli replication origin: ColE1
       •    Copy number: low

p53-ABAI-polyclonal-site

 

p53-ABAI Sequence

 

LOCUS       Exported                4944 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    p53-AbAi
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4944)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 10, 2016
 
 
COMMENT     Created by Clontech Laboratories Inc. http://www.clontech.com
            Cat. No. 630491
FEATURES             Location/Qualifiers
     source          1..4944
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        25..83
                     /note="p53 binding site"
     misc_feature    235..1440
                     /note="Aur1-C"
                     /note="Aureobasidin Resistance"
     rep_origin      2209..2659
                     /note="pUC origin"
     misc_feature    complement(2856..3716)
                     /note="Amp(R)"
     misc_feature    complement(3925..4727)
                     /note="URA3"
ORIGIN
        1 aagcttgaat tcgagctcgg taccaggcat gcctagcatg cctaggcatg cctaggcatg
       61 cctaggcatg cctaggcatg cctggatccc tcgaggcatg tgctctgtat gtatataaaa
      121 ctcttgtttt cttcttttct ctaaatattc tttccttata cattaggtcc tttgtagcat
      181 aaattactat acttctatag acacgcaaac acaaatacac acactaaatt aataatggca
      241 aacccttttt cgagatggtt tctatcagag agacctccaa actgccatgt agccgattta
      301 gaaacaagtt tagatcccca tcaaacgttg ttgaaggtgc aaaaatacaa acccgcttta
      361 agcgactggg tgcattacat cttcttggga tccatcatgc tgtttgtgtt cattactaat
      421 cccgcacctt ggatcttcaa gatccttttt tattgtttct tgggcacttt attcatcatt
      481 ccagctacgt cacagttttt cttcaatgcc ttgcccatcc taacatgggt ggcgctgtat
      541 ttcacttcat cgtactttcc agatgaccgc aggcctccta ttactgtcaa agtgttacca
      601 gcggtggaaa caattttata cggcgacaat ttaagtgata ttcttgcaac atcgacgaat
      661 tcctttttgg acattttagc atggttaccg tacggactat ttcattatgg ggccccattt
      721 gtcgttgctg ccatcttatt cgtatttggt ccaccaactg ttttgcaagg ttatgctttt
      781 gcatttggtt atatgaacct gtttggtgtt atcatgcaaa atgtctttcc agccgctccc
      841 ccatggtata aaattctcta tggattgcaa tcagccaact atgatatgca tggctcgcct
      901 ggtggattag ctagaattga taagctactc ggtattaata tgtatactac atgtttttca
      961 aattcctccg tcattttcgg tgcttttcct tcactgcatt ccgggtgtgc tactatggaa
     1021 gccctgtttt tctgttattg ttttccaaaa ttgaagccct tgtttattgc ttatgtttgc
     1081 tggttatggt ggtcaactat gtatctgaca caccattatt ttgtagacct tatggcaggt
     1141 tctgtgctgt catacgttat tttccagtac acaaagtaca cacatttacc aattgtagat
     1201 acatctcttt tttgcagatg gtcatacact tcaattgaga aatacgatat atcaaagagt
     1261 gatccattgg ctgcagattc aaacgatatc gaaagtgtcc ctttgtccaa cttggaactt
     1321 gactttgatc ttaatatgac tgatgaaccc agtgtaagcc cttcgttatt tgatggatct
     1381 acttctgttt ctcgttcgtc cgccacgtct ataacgtcac taggtgtaaa gagggcttaa
     1441 ggaaatccat tatgtactat ttaaaaaaca caaacttttg gatgttcggt ttattctttt
     1501 tcttttactt ttttatcatg ggagcctact tcccgttttt cccgatttgg ctacatgaca
     1561 tcaaccatat cagcaaaagt gatacgggta ttatttttgc cgctatttct ctgttctcgc
     1621 tattattcca accgctgttt ggtctgcttt ctgacaaact cggcctcgac tctagcgaat
     1681 taattcgtaa tcatgtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca
     1741 cacaacatac gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa
     1801 ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag
     1861 ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc
     1921 gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct
     1981 cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg
     2041 tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc
     2101 cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga
     2161 aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct
     2221 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg
     2281 gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag
     2341 ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat
     2401 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac
     2461 aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac
     2521 tacggctaca ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc
     2581 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt
     2641 tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc
     2701 ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg
     2761 agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca
     2821 atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca
     2881 cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag
     2941 ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac
     3001 ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc
     3061 agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct
     3121 agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc
     3181 gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg
     3241 cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc
     3301 gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat
     3361 tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag
     3421 tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aacacgggat
     3481 aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg
     3541 cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca
     3601 cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga
     3661 aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc
     3721 ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata
     3781 tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg
     3841 ccacctgggt aataactgat ataattaaat tgaagctcta atttgtgagt ttagtataca
     3901 tgcatttact tataatacag ttttttagtt ttgctggccg catcttctca aatatgcttc
     3961 ccagcctgct tttctgtaac gttcaccctc taccttagca tcccttccct ttgcaaatag
     4021 tcctcttcca acaataataa tgtcagatcc tgtagagacc acatcatcca cggttctata
     4081 ctgttgaccc aatgcgtctc ccttgtcatc taaacccaca ccgggtgtca taatcaacca
No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart