pAAV- IRES- hrGFP Plasmid

$182.00

  • Model: PVT2104
  • 50 Units in Stock
Ask a question


Add to Cart:

pAAV-IRES-hrGFP

Search name

pAAV-IRES-hrGFP,Plasmid pAAV-IRES-hrGFP,pAAV-IRES-hrGFP vector

 

pAAV-IRES-hrGFP Information

Promoter: CMV, T7

Replicator: pUC ori, F1 ori

Terminator: hGH poly (A) signal

Plasmid classification: virus series, adenovirus associated cloning vector.

Plasmid size: 6.1kb

Prokaryotic resistance: Amp

Cloned strain: Stbl3

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: hGH-PA-R: CCAGCTTGGTTCCCAATAGA

 

pAAV-IRES-hrGFP Description

pAAV-IRES-hrGFP can accommodate insertion of less than 1.7 KB

pAAV-IRES-hrGFP-vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart