pAAV- IRES- ZsGreen1


  • Model: PVT11044
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11044
Packing 2ug


pAAV-IRES-ZsGreen1 Information

Promoter: CMV

Replicon: pUC ori, F1 ori

Terminator: hGH poly (A) signal

Plasmid classification: virus series, adenovirus associated cloning vector

Plasmid size: 5904bp

Prokaryotic resistance: Amp

Clone strain: Stbl3

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.


3'sequencing primers: hGH-PA-R: CCAGCTTGGTTCCCAATAGA


pAAV-IRES-ZsGreen1 Description

The pAAV-ZsGreen1 Vector is an adeno-associated virus (AAV) vector that contains the ZsGreen1 gene. This vector can be used as a positive control to monitor AAV particle production using AAVpro Helper Free Systems. Expression of ZsGreen, a variant of the green fluorescent protein from Zoanthus sp., can be used to assess transfection and transduction efficiency during AAV particle preparation.


pAAV-IRES-ZsGreen1 Multiple cloning site





pAAV-IRES-ZsGreen1 Sequence

LOCUS       Exported                5904 bp ds-DNA     circular SYN 06-AUG-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5904)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 6, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5904
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     repeat_region   1..141
                     /note="AAV2 ITR"
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     enhancer        221..524
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        525..727
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     misc_feature    1345..1917
                     /note="internal ribosome entry site (IRES) of the 
                     encephalomyocarditis virus (EMCV)"
     misc_feature    1368..1919
                     /note="internal ribosome entry site (IRES) of the 
                     encephalomyocarditis virus (EMCV)"
     CDS             1919..2614
                     /product="Zoanthus green fluorescent protein"
                     /note="mammalian codon-optimized"
     polyA_signal    2651..3127
                     /note="hGH poly(A) signal"
                     /note="human growth hormone polyadenylation signal"
     repeat_region   3167..3307
                     /note="AAV2 ITR"
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     rep_origin      3382..3837
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        4119..4223
                     /note="AmpR promoter"
     CDS             4224..5084
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      5255..5843
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc
       61 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca
      121 actccatcac taggggttcc tgcggccgca cgcgtggagc tagttattaa tagtaatcaa
      181 ttacggggtc attagttcat agcccatata tggagttccg cgttacataa cttacggtaa
      241 atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg
      301 ttcccatagt aacgtcaata gggactttcc attgacgtca atgggtggag tatttacggt
      361 aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg
      421 tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc
      481 ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc
      541 agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca
      601 ttgacgtcaa tgggagtttg ttttgcacca aaatcaacgg gactttccaa aatgtcgtaa
      661 caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag
      721 cagagctcgt ttagtgaacc gtcagatcgc ctggagacgc catccacgct gttttgacct
      781 ccatagaaga caccgggacc gatccagcct ccgcggattc gaatcccggc cgggaacggt
      841 gcattggaac gcggattccc cgtgccaaga gtgacgtaag taccgcctat agagtctata
      901 ggcccacaaa aaatgctttc ttcttttaat atactttttt gtttatctta tttctaatac
      961 tttccctaat ctctttcttt cagggcaata atgatacaat gtatcatgcc tctttgcacc
     1021 attctaaaga ataacagtga taatttctgg gttaaggcaa tagcaatatt tctgcatata
     1081 aatatttctg catataaatt gtaactgatg taagaggttt catattgcta atagcagcta
     1141 caatccagct accattctgc ttttatttta tggttgggat aaggctggat tattctgagt
     1201 ccaagctagg cccttttgct aatcatgttc atacctctta tcttcctccc acagctcctg
     1261 ggcaacgtgc tggtctgtgt gctggcccat cactttggca aagaattggg attcgaacat
     1321 cgattgaatt ccccggggat cccgcccctc tccctccccc ccccctaacg ttactggccg
     1381 aagccgcttg gaataaggcc ggtgtgcgtt tgtctatatg ttattttcca ccatattgcc
     1441 gtcttttggc aatgtgaggg cccggaaacc tggccctgtc ttcttgacga gcattcctag
     1501 gggtctttcc cctctcgcca aaggaatgca aggtctgttg aatgtcgtga aggaagcagt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
