
  • Model: PVT2102
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT2102     2ug


pAAV-MCS Information

Promoter: CMV

Replicator: pUC ori, F1 ori

Terminator: hGH poly (A) signal

Plasmid classification: virus series, adenovirus associated cloning vector

Plasmid size: 4650bp

Prokaryotic resistance: Amp

Cloned strain: Stbl3

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression


3'sequencing primers: hGH-PA-R: CCAGCTTGGTTCCCAATAGA


pAAV-MCS Description

pAAV-MCS vector contains high levels of genes in mammalian cells.



PVT2102 pAAV-MCS Reference
Article: Transmisión glicinérgica y alcoholismo : desarrollo de un vector adenoasociado codificante de una versión mutada (KK385/386AA) de la subunidad Alfa 1 del receptor de glicina
Author: Maldonado Lazo, Adolfo Javier;
Professor Guide: Rivera Meza, Mario; Aguayo Hernández, Luis Gerardo;
Tesis Postgrado


pAAV-MCS Sequence

LOCUS       Exported                4650 bp ds-DNA     circular SYN 15-AUG-2018

DEFINITION  synthetic circular DNA


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4650)

  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..4650

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     repeat_region   1..141

                     /note="AAV2 ITR"

                     /note="inverted terminal repeat of adeno-associated virus 

                     serotype 2"

     enhancer        221..524

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        525..727

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     misc_feature    820..1312

                     /note="beta-globin Intron"

     misc_feature    1319..1394


     polyA_signal    1397..1873

                     /note="hGH poly(A) signal"

                     /note="human growth hormone polyadenylation signal"

     repeat_region   1913..2053

                     /note="AAV2 ITR"

                     /note="inverted terminal repeat of adeno-associated virus 

                     serotype 2"

     rep_origin      2128..2583


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     promoter        2865..2969


                     /note="AmpR promoter"

     CDS             2970..3830





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      4001..4589



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 



        1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc

       61 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca

      121 actccatcac taggggttcc tgcggccgca cgcgtggagc tagttattaa tagtaatcaa

      181 ttacggggtc attagttcat agcccatata tggagttccg cgttacataa cttacggtaa

      241 atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg

      301 ttcccatagt aacgtcaata gggactttcc attgacgtca atgggtggag tatttacggt

      361 aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg

      421 tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc

      481 ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc

      541 agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca

      601 ttgacgtcaa tgggagtttg ttttgcacca aaatcaacgg gactttccaa aatgtcgtaa

      661 caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag

      721 cagagctcgt ttagtgaacc gtcagatcgc ctggagacgc catccacgct gttttgacct

      781 ccatagaaga caccgggacc gatccagcct ccgcggattc gaatcccggc cgggaacggt

      841 gcattggaac gcggattccc cgtgccaaga gtgacgtaag taccgcctat agagtctata

      901 ggcccacaaa aaatgctttc ttcttttaat atactttttt gtttatctta tttctaatac

      961 tttccctaat ctctttcttt cagggcaata atgatacaat gtatcatgcc tctttgcacc

     1021 attctaaaga ataacagtga taatttctgg gttaaggcaa tagcaatatt tctgcatata

     1081 aatatttctg catataaatt gtaactgatg taagaggttt catattgcta atagcagcta

     1141 caatccagct accattctgc ttttatttta tggttgggat aaggctggat tattctgagt

     1201 ccaagctagg cccttttgct aatcatgttc atacctctta tcttcctccc acagctcctg

     1261 ggcaacgtgc tggtctgtgt gctggcccat cactttggca aagaattggg attcgaacat

     1321 cgattgaatt ccccggggat cctctagagt cgacctgcag aagcttgcct cgagcagcgc

     1381 tgctcgagag atctacgggt ggcatccctg tgacccctcc ccagtgcctc tcctggccct

     1441 ggaagttgcc actccagtgc ccaccagcct tgtcctaata aaattaagtt gcatcatttt

     1501 gtctgactag gtgtccttct ataatattat ggggtggagg ggggtggtat ggagcaaggg

     1561 gcaagttggg aagacaacct gtagggcctg cggggtctat tgggaaccaa gctggagtgc

     1621 agtggcacaa tcttggctca ctgcaatctc cgcctcctgg gttcaagcga ttctcctgcc

     1681 tcagcctccc gagttgttgg gattccaggc atgcatgacc aggctcagct aatttttgtt

     1741 tttttggtag agacggggtt tcaccatatt ggccaggctg gtctccaact cctaatctca

     1801 ggtgatctac ccaccttggc ctcccaaatt gctgggatta caggcgtgaa ccactgctcc

     1861 cttccctgtc cttctgattt tgtaggtaac cacgtgcgga ccgagcggcc gcaggaaccc

     1921 ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga

     1981 ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc

     2041 agctgcctgc aggggcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca

     2101 caccgcatac gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg

     2161 gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt

     2221 tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc

     2281 gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg

     2341 atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga

     2401 cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc

     2461 ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa

     2521 aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta acgtttacaa

     2581 ttttatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagccccgac

     2641 acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca tccgcttaca

     2701 gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg tcatcaccga

     2761 aacgcgcgag acgaaagggc ctcgtgatac gcctattttt ataggttaat gtcatgataa

     2821 taatggtttc ttagacgtca ggtggcactt ttcggggaaa tgtgcgcgga acccctattt

     2881 gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa ccctgataaa

     2941 tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt gtcgccctta

     3001 ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg ctggtgaaag

     3061 taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg gatctcaaca

     3121 gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg agcactttta

     3181 aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag caactcggtc

     3241 gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca gaaaagcatc

     3301 ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg agtgataaca

     3361 ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc gcttttttgc

     3421 acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg aatgaagcca

     3481 taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac

     3541 tattaactgg cgaactactt actctagctt cccggcaaca attaatagac tggatggagg

     3601 cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg tttattgctg

     3661 ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg gggccagatg

     3721 gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact atggatgaac

     3781 gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa ctgtcagacc

     3841 aagtttactc atatatactt tagattgatt taaaacttca tttttaattt aaaaggatct

     3901 aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc

     3961 actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct ttttttctgc

     4021 gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt tgtttgccgg

     4081 atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg cagataccaa

     4141 atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct gtagcaccgc

     4201 ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc gataagtcgt

     4261 gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg tcgggctgaa

     4321 cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa ctgagatacc

     4381 tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc

     4441 cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg ggaaacgcct

     4501 ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga tttttgtgat

     4561 gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt ttacggttcc

     4621 tggccttttg ctggcctttt gctcacatgt




Search name

pAAV-MCS,Plasmid pAAV-MCS,pAAV-MCS vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
