pAAV- MCS Plasmid


  • Model: PVT2102
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pAAV-MCS,Plasmid pAAV-MCS,pAAV-MCS vector


pAAV-MCS Information

Promoter: CMV

Replicator: pUC ori, F1 ori

Terminator: hGH poly (A) signal

Plasmid classification: virus series, adenovirus associated cloning vector

Plasmid size: 4650bp

Prokaryotic resistance: Amp

Cloned strain: Stbl3

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression


3'sequencing primers: hGH-PA-R: CCAGCTTGGTTCCCAATAGA


pAAV-MCS Description

pAAV-MCS vector contains high levels of genes in mammalian cells.



pAAV-MCS Sequence

LOCUS       Exported                4650 bp ds-DNA     circular SYN 27-AUG-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 8
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4650)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, August 27, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4650
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     repeat_region   1..141
                     /note="AAV2 ITR"
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     enhancer        221..524
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        525..727
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     polyA_signal    1397..1873
                     /note="hGH poly(A) signal"
                     /note="human growth hormone polyadenylation signal"
     repeat_region   1913..2053
                     /note="AAV2 ITR"
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     rep_origin      2128..2583
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        2865..2969
                     /note="AmpR promoter"
     CDS             2970..3830
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      4001..4589
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc
       61 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca
      121 actccatcac taggggttcc tgcggccgca cgcgtggagc tagttattaa tagtaatcaa
      181 ttacggggtc attagttcat agcccatata tggagttccg cgttacataa cttacggtaa
      241 atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg
      301 ttcccatagt aacgtcaata gggactttcc attgacgtca atgggtggag tatttacggt
      361 aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg
      421 tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc
      481 ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc
      541 agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca
      601 ttgacgtcaa tgggagtttg ttttgcacca aaatcaacgg gactttccaa aatgtcgtaa
      661 caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag
      721 cagagctcgt ttagtgaacc gtcagatcgc ctggagacgc catccacgct gttttgacct
      781 ccatagaaga caccgggacc gatccagcct ccgcggattc gaatcccggc cgggaacggt
      841 gcattggaac gcggattccc cgtgccaaga gtgacgtaag taccgcctat agagtctata
      901 ggcccacaaa aaatgctttc ttcttttaat atactttttt gtttatctta tttctaatac
      961 tttccctaat ctctttcttt cagggcaata atgatacaat gtatcatgcc tctttgcacc
     1021 attctaaaga ataacagtga taatttctgg gttaaggcaa tagcaatatt tctgcatata
     1081 aatatttctg catataaatt gtaactgatg taagaggttt catattgcta atagcagcta
     1141 caatccagct accattctgc ttttatttta tggttgggat aaggctggat tattctgagt
     1201 ccaagctagg cccttttgct aatcatgttc atacctctta tcttcctccc acagctcctg
     1261 ggcaacgtgc tggtctgtgt gctggcccat cactttggca aagaattggg attcgaacat
     1321 cgattgaatt ccccggggat cctctagagt cgacctgcag aagcttgcct cgagcagcgc
     1381 tgctcgagag atctacgggt ggcatccctg tgacccctcc ccagtgcctc tcctggccct
     1441 ggaagttgcc actccagtgc ccaccagcct tgtcctaata aaattaagtt gcatcatttt
     1501 gtctgactag gtgtccttct ataatattat ggggtggagg ggggtggtat ggagcaaggg
     1561 gcaagttggg aagacaacct gtagggcctg cggggtctat tgggaaccaa gctggagtgc
     1621 agtggcacaa tcttggctca ctgcaatctc cgcctcctgg gttcaagcga ttctcctgcc
     1681 tcagcctccc gagttgttgg gattccaggc atgcatgacc aggctcagct aatttttgtt
     1741 tttttggtag agacggggtt tcaccatatt ggccaggctg gtctccaact cctaatctca
     1801 ggtgatctac ccaccttggc ctcccaaatt gctgggatta caggcgtgaa ccactgctcc
     1861 cttccctgtc cttctgattt tgtaggtaac cacgtgcgga ccgagcggcc gcaggaaccc
     1921 ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga
     1981 ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc
     2041 agctgcctgc aggggcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca
     2101 caccgcatac gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg
     2161 gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt
     2221 tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc
     2281 gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg
     2341 atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga
     2401 cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc
     2461 ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa
     2521 aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta acgtttacaa
     2581 ttttatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagccccgac
     2641 acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca tccgcttaca
     2701 gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg tcatcaccga
     2761 aacgcgcgag acgaaagggc ctcgtgatac gcctattttt ataggttaat gtcatgataa
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
