pABAI Plasmid


  • Model: PVT4022
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4022  2ug

pABAI Plasmid Information

Promoter: URA3 promoter

Replicon: ColE1 ori

Plasmid classification: yeast series plasmids; yeast hybrid plasmids; single hybrid plasmids

Plasmid size: 4894bp

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Screening markers: URA3

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Y1Hgold and other yeast

Culture conditions: 30 centigrade, YPDA, aerobic


3'sequencing primers: pABAI-R (CCATCTCGAAAAAGGGTTTGCC)

Remarks: low copy plasmids

Use: Yeast expression


pABAI Plasmid Desciption

pABAI is a yeast reporter vector that can be used in one-hybrid assays to identify and characterize DNA-binding proteins. The vector, which was specifically designed for use with the Matchmaker Gold Yeast One-Hybrid Library Screening System, contains a multiple cloning site upstream of the yeast iso-1-cytochrome C minimal promoter(not shown) and the AUR1-C gene, an antibiotic resistance gene that confers resistance to Aureobasidin A. A cis-acting element (i.e., a target sequence) can be inserted into the MCS and used as bait to screen GAL4 AD/cDNA fusion libraries for proteins that interact with the target sequence. Positive protein-DNA (i.e.,one-hybrid) interactions drive the expression of AUR1-C. As a result, one-hybrid interactions can be detected by selecting for yeast that are resistant to AbA.
          pABAI cannot be propagated episomally in yeast; it can only be stablymaintained through integration into the host genome. Integration is accomplished via homologous recombination between the vector’s URA3 gene and the ura3-52 locus of the yeast strain provided in theMatchmaker Gold Yeast One-Hybrid System. URA3 is a nutritional marker that can also be used for selection of recombinant yeast. The vector also contains a Col E1 origin of replication and an ampicillin resistance gene (Ampr) for propagation and selection in E.coli.
          To use pAbAi in a one-hybrid assay, clone one or more copies of a cis-acting element into the MCS. To facilitate recombination of the vector with the host’s ura3-52 locus, linearize the vector with either BbsI or BstBI, then introduce the linearized vector into competent yeast cells using the protocols in the Matchmaker Gold Yeast One-Hybrid Library Screening System User Manual.
          Insertion of your target sequence may alter the basal expression of AUR1-C. Therefore, before starting a onehybrid analysis, basal levels of AUR1-C should be determined as described in the User Manual.
          •    Suitable host strains: DH5α and other general purpose strains.
          •    Selectable marker: plasmid confers resistance to ampicillin (100 µg/ml) to E. coli hosts.
          •    Copy number: low



pABAI Plasmid Sequence

LOCUS       Exported                4894 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 21
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4894)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 10, 2016  
FEATURES             Location/Qualifiers
     source          1..4894
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             185..1390
                     /gene="S. cerevisiae AUR1 with a dominant F158Y mutation"
                     /product="aureobasidin A-resistant mutant of inositol 
                     phosphorylceramide synthase"
                     /note="confers fungal resistance to Aureobasidin A"
     primer_bind     complement(1645..1661)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     protein_bind    1669..1685
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1693..1723)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    1738..1759
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     rep_origin      complement(2047..2635)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(2806..3666)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3667..3771)
                     /note="AmpR promoter"
     CDS             complement(3875..4678)
                     /gene="S. cerevisiae URA3"
                     /product="orotidine-5'-phosphate decarboxylase, required 
                     for uracil biosynthesis"
                     /note="yeast auxotrophic marker, counterselectable with 
                     5-fluoroorotic acid (5-FOA)"
     promoter        complement(4679..4894)
                     /gene="S. cerevisiae URA3"
                     /note="URA3 promoter"


        1 aagcttgaat tcgagctcgg tacccgggga tctgtcgacc tcgaggcatg tgctctgtat

       61 gtatataaaa ctcttgtttt cttcttttct ctaaatattc tttccttata cattaggtcc

      121 tttgtagcat aaattactat acttctatag acacgcaaac acaaatacac acactaaatt

      181 aataatggca aacccttttt cgagatggtt tctatcagag agacctccaa actgccatgt

      241 agccgattta gaaacaagtt tagatcccca tcaaacgttg ttgaaggtgc aaaaatacaa

      301 acccgcttta agcgactggg tgcattacat cttcttggga tccatcatgc tgtttgtgtt

      361 cattactaat cccgcacctt ggatcttcaa gatccttttt tattgtttct tgggcacttt

      421 attcatcatt ccagctacgt cacagttttt cttcaatgcc ttgcccatcc taacatgggt

      481 ggcgctgtat ttcacttcat cgtactttcc agatgaccgc aggcctccta ttactgtcaa

      541 agtgttacca gcggtggaaa caattttata cggcgacaat ttaagtgata ttcttgcaac

      601 atcgacgaat tcctttttgg acattttagc atggttaccg tacggactat ttcattatgg

      661 ggccccattt gtcgttgctg ccatcttatt cgtatttggt ccaccaactg ttttgcaagg

      721 ttatgctttt gcatttggtt atatgaacct gtttggtgtt atcatgcaaa atgtctttcc

      781 agccgctccc ccatggtata aaattctcta tggattgcaa tcagccaact atgatatgca

      841 tggctcgcct ggtggattag ctagaattga taagctactc ggtattaata tgtatactac

      901 atgtttttca aattcctccg tcattttcgg tgcttttcct tcactgcatt ccgggtgtgc

      961 tactatggaa gccctgtttt tctgttattg ttttccaaaa ttgaagccct tgtttattgc

     1021 ttatgtttgc tggttatggt ggtcaactat gtatctgaca caccattatt ttgtagacct

     1081 tatggcaggt tctgtgctgt catacgttat tttccagtac acaaagtaca cacatttacc

     1141 aattgtagat acatctcttt tttgcagatg gtcatacact tcaattgaga aatacgatat

     1201 atcaaagagt gatccattgg ctgcagattc aaacgatatc gaaagtgtcc ctttgtccaa

     1261 cttggaactt gactttgatc ttaatatgac tgatgaaccc agtgtaagcc cttcgttatt

     1321 tgatggatct acttctgttt ctcgttcgtc cgccacgtct ataacgtcac taggtgtaaa

     1381 gagggcttaa ggaaatccat tatgtactat ttaaaaaaca caaacttttg gatgttcggt

     1441 ttattctttt tcttttactt ttttatcatg ggagcctact tcccgttttt cccgatttgg

     1501 ctacatgaca tcaaccatat cagcaaaagt gatacgggta ttatttttgc cgctatttct

     1561 ctgttctcgc tattattcca accgctgttt ggtctgcttt ctgacaaact cggcctcgac

     1621 tctagcgaat taattcgtaa tcatgtcata gctgtttcct gtgtgaaatt gttatccgct

     1681 cacaattcca cacaacatac gagccggaag cataaagtgt aaagcctggg gtgcctaatg

     1741 agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct

     1801 gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg

     1861 gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc

     1921 ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg

     1981 aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct

     2041 ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca

     2101 gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct

     2161 cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc

     2221 gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt

     2281 tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc

     2341 cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc

     2401 cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg

     2461 gtggcctaac tacggctaca ctagaagaac agtatttggt atctgcgctc tgctgaagcc

     2521 agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag

     2581 cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga

     2641 tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat

     2701 tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag

     2761 ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat

     2821 cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc

     2881 cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat

     2941 accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag

     3001 ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg

     3061 ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc

     3121 tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca

     3181 acgatcaagg cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg

     3241 tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc

     3301 actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta

     3361 ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc

     3421 aacacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg

     3481 ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc

     3541 cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc

     3601 aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat

     3661 actcatactc ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag

     3721 cggatacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc

     3781 ccgaaaagtg ccacctgggt aataactgat ataattaaat tgaagctcta atttgtgagt

     3841 ttagtataca tgcatttact tataatacag ttttttagtt ttgctggccg catcttctca

     3901 aatatgcttc ccagcctgct tttctgtaac gttcaccctc taccttagca tcccttccct

     3961 ttgcaaatag tcctcttcca acaataataa tgtcagatcc tgtagagacc acatcatcca

     4021 cggttctata ctgttgaccc aatgcgtctc ccttgtcatc taaacccaca ccgggtgtca

     4081 taatcaacca atcgtaacct tcatctcttc cacccatgtc tctttgagca ataaagccga

     4141 taacaaaatc tttgtcgctc ttcgcaatgt caacagtacc cttagtatat tctccagtag

     4201 atagggagcc cttgcatgac aattctgcta acatcaaaag gcctctaggt tcctttgtta

     4261 cttcttctgc cgcctgcttc aaaccgctaa caatacctgg gcccaccaca ccgtgtgcat

     4321 tcgtaatgtc tgcccattct gctattctgt atacacccgc agagtactgc aatttgactg

     4381 tattaccaat gtcagcaaat tttctgtctt cgaagagtaa aaaattgtac ttggcggata

     4441 atgcctttag cggcttaact gtgccctcca tggaaaaatc agtcaagata tccacatgtg

     4501 tttttagtaa acaaattttg ggacctaatg cttcaactaa ctccagtaat tccttggtgg

     4561 tacgaacatc caatgaagca cacaagtttg tttgcttttc gtgcatgata ttaaatagct

     4621 tggcagcaac aggactagga tgagtagcag cacgttcctt atatgtagct ttcgacatga

     4681 tttatcttcg tttcctgcag gtttttgttc tgtgcagttg ggttaagaat actgggcaat

     4741 ttcatgtttc ttcaacacta catatgcgta tatataccaa tctaagtctg tgctccttcc

     4801 ttcgttcttc cttctgttcg gagattaccg aatcaaaaaa atttcaagga aaccgaaatc

     4861 aaaaaaaaga ataaaaaaaa aatgatgaat tgaa



Search name

pABAI,Plasmid pABAI,pABAI vector

* Product is used for research only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
