pAC5.1b-EGFP

Search name

pAC5.1b-EGFP,Plasmid pAC5.1b-EGFP,pAC5.1b-EGFP vector

 

pAC5.1b-EGFP Information

Promoter: Ac5 promoter

Replicon: pUC ori

Terminator: SV40 poly (A) signal

Plasmid classification: insect series plasmids, insect free plasmids, insect intracellular plasmids.

Plasmid size: 6072bp

Plasmid Tags: N-EGFP, C-V5, C-6 x His

Prokaryotic resistance: ampicillin Ampicillin

Screening markers: no

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Drosophila cell line S2

Induction mode: constituent expression without induction

5'sequencing primers: Ac5-F:ACACAAAGCCGCTCCATCAG

3'sequencing primers: BGH-R:TAGAAGGCACAGTCGAGG

Note: non virus

Use:Insect cell plasmid

 

pAC5.1b-EGFP Description

PAC5.1b-EGFP plasmid is an expression vector of an insect cell group. Ac5 promoter drives EGFP tags, target genes, Myc tags and 6 x HIS tags together to express them together. It can be co transfected with pCoHygro or pCoBlast and establish a stable expression cell line.

pAC5.1b-EGFP is a 6kb expression vector designed for use with the Drosophila Constitutive Expression System available from Invitrogen. Upon transfection, the vector allows transient expression of your protein of interest in Drosophila cells. When cotransfected with the selection vector, pCoHygro or pCoBlast, pAC5.1b-EGFP allows selection of stable cell lines exhibiting constitutive expression of the protein of interest.
            • The Drosophila actin 5C (Ac5) promoter for high-level, constitutive expression of the gene of interest in S2 cells (Chung and Keller, 1990).
            • Multiple cloning site to facilitate cloning the gene of interest.
            • C-terminal peptide containing the V5 epitope and polyhistidine (6xHis) tag for detection and purification of your protein of interest (if desired).
            • Three reading frames to facilitate in-frame cloning with the C-terminal peptide.
            • N-terminal EGFP tag for better detection.
            • Ampicillin resistance gene for selection of transformants in E. coli.

 

pAC5.1b-EGFP Sequence