pAC5.1b- EGFP Plasmid


  • Model: PVT5107
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pAC5.1b-EGFP,Plasmid pAC5.1b-EGFP,pAC5.1b-EGFP vector


pAC5.1b-EGFP Information

Promoter: Ac5 promoter

Replicon: pUC ori

Terminator: SV40 poly (A) signal

Plasmid classification: insect series plasmids, insect free plasmids, insect intracellular plasmids.

Plasmid size: 6072bp

Plasmid Tags: N-EGFP, C-V5, C-6 x His

Prokaryotic resistance: ampicillin Ampicillin

Screening markers: no

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Drosophila cell line S2

Induction mode: constituent expression without induction

5'sequencing primers: Ac5-F:ACACAAAGCCGCTCCATCAG

3'sequencing primers: BGH-R:TAGAAGGCACAGTCGAGG

Note: non virus

Use:Insect cell plasmid


pAC5.1b-EGFP Description

PAC5.1b-EGFP plasmid is an expression vector of an insect cell group. Ac5 promoter drives EGFP tags, target genes, Myc tags and 6 x HIS tags together to express them together. It can be co transfected with pCoHygro or pCoBlast and establish a stable expression cell line.

pAC5.1b-EGFP is a 6kb expression vector designed for use with the Drosophila Constitutive Expression System available from Invitrogen. Upon transfection, the vector allows transient expression of your protein of interest in Drosophila cells. When cotransfected with the selection vector, pCoHygro or pCoBlast, pAC5.1b-EGFP allows selection of stable cell lines exhibiting constitutive expression of the protein of interest.
            • The Drosophila actin 5C (Ac5) promoter for high-level, constitutive expression of the gene of interest in S2 cells (Chung and Keller, 1990).

            • Multiple cloning site to facilitate cloning the gene of interest.
            • C-terminal peptide containing the V5 epitope and polyhistidine (6xHis) tag for detection and purification of your protein of interest (if desired).
            • Three reading frames to facilitate in-frame cloning with the C-terminal peptide.
            • N-terminal EGFP tag for better detection.
            • Ampicillin resistance gene for selection of transformants in E. coli.



pAC5.1b-EGFP Sequence

LOCUS       Exported                6072 bp ds-DNA     circular SYN 23-MAY-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6072)
  TITLE     Direct Submission
  JOURNAL   Exported Monday, May 23, 2016 
FEATURES             Location/Qualifiers
     source          1..6072
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        56..2568
                     /note="Ac5 promoter"
                     /note="Drosophila melanogaster actin 5C promoter"
     CDS             2617..3339
                     /product="enhanced GFP"
                     /note="mammalian codon-optimized"
     CDS             3357..3398
                     /product="epitope tag from simian virus 5"
                     /note="V5 tag"
     CDS             3408..3425
                     /product="6xHis affinity tag"
     polyA_signal    3498..3632
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(4254..4842)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(5013..5873)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(5874..5978)
                     /note="AmpR promoter"
        1 cttcaaggaa ttaattctat attctaaaaa cacaaatgat acttctaaaa aaaatcatga
       61 atggcatcaa ctctgaatca aatctttgca gatgcaccta cttctcattt ccactgtcac
      121 atcatttttc cagatctcgc tgcctgttat gtggcccaca aaccaagaca cgttttatgg
      181 ccattaaagc tggctgatcg tcgccaaaca ccaaatacat atcaatatgt acattcgaga
      241 aagaagcgat caaagaagcg tcttcgggcg agtaggagaa tgcggaggag aaggagaacg
      301 agctgatcta gtatctctcc acaatccaat gccaactgac caactggcca tattcggagc
      361 aatttgaagc caatttccat cgcctggcga tcgctccatt cttggctata tgtttttcac
      421 cgttcccggg gccattttca aagactcgtc ggtaagataa gattgtgtca ctcgctgtct
      481 ctcttcattt gtcgaagaat gctgaggaat ttcgcgatga cgtcggcgag tattttgaag
      541 aatgagaata atttgtattt atacgaaaat cagttagtgg aattttctac aaaaacatgt
      601 tatctataga taattttgtt gcaaaatatg ttgactatga caaagattgt atgtatatac
      661 ctttaatgta ttctcatttt cttatgtatt tataatggca atgatgatac tgatgatatt
      721 ttaagatgat gccagaccac aggctgattt ctgcgtcttt tgccgaacgc agtgcatgtg
      781 cggttgttgt tttttggaat agtttcaatt ttcggactgt ccgctttgat ttcagtttct
      841 tggcttattc aaaaagcaaa gtaaagccaa aaaagcgaga tggcaatacc aaatgcggca
      901 aaacggtagt ggaaggaaag gggtgcgggg cagcggaagg aagggtgggg cggggcgtgg
      961 cggggtctgt ggctgggcgc gacgtcaccg acgttggagc cactcctttg accatgtgtg
     1021 cgtgtgtgta ttattcgtgt ctcgccactc gccggttgtt tttttctttt tatctcgctc
     1081 tctctagcgc catctcgtac gcatgctcaa cgcaccgcat gttgccgtgt cctttatgcg
     1141 tcattttggc tcgaaatagg caattattta aacaaagatt agtcaacgaa aacgctaaaa
     1201 taaataagtc tacaatatgg ttacttattg ccatgtgtgt gcagccaacg atagcaacaa
     1261 aagcaacaac acagtggctt tccctctttc actttttgtt tgcaagcgcg tgcgagcaag
     1321 acggcacgac cggcaaacgc aattacgctg acaaagagca gacgaagttt tggccgaaaa
     1381 acatcaaggc gcctgatacg aatgcatttg caataacaat tgcgatattt aatattgttt
     1441 atgaagctgt ttgacttcaa aacacacaaa aaaaaaaata aaacaaatta tttgaaagag
     1501 aattaggaat cggacagctt atcgttacgg gctaacagca caccgagacg aaatagctta
     1561 cctgacgtca cagcctctgg aagaactgcc gccaagcaga gagagagaga aaaagaggga
     1621 gagcagctta gaccgcatgt gcttgtgtgt gaggcgtctc tctcttcgtc tcctgtttgc
     1681 gcaaacgcat agactgcact gagaaaatcg attacctatt ttttatgaat gaatatttgc
     1741 actattacta ttcaaaacta ttaagatagc aatcacattc aatagccaaa tactatacca
     1801 cctgagcgat gcaacgaaat gatcaatttg agcaaaaatg ctgcatattt aggacggcat
     1861 cattatagaa atgcttcttg ctgtgtactt ttctctcgtc tggcagctgt ttcgccgtta
     1921 ttgttaaaac cggcttaagt taggtgtgtt ttctacgact agtgatgccc ctactagaag
     1981 atgtgtgttg cacaaatgtc cctgaataac caatttgaag tgcagatagc agtaaacgta
     2041 agctaatatg aatattattt aactgtaatg ttttaatatc gctggacatt actaataaac
     2101 ccactataaa cacatgtaca tatgtatgtt tt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
