pACBSR-hyg

$198.00

  • Model: PVT18798
  • 50 Units in Stock
Ask a question


Add to Cart:

pACBSR-hyg

 

Product Name: pACBSR-hyg
Cat No.: PVT18798
Alternative Name: pACBSR-hyg,pACBSR-hyg vector,pACBSR-hyg plasmid,pACBSR-hyg map,pACBSR-hyg sequence
Plasmid form: Freeze-dried powder
Storage Condition: -20 Centigrade
Bulk order Please contact us: sales@lifescience-market.com
Promoter: araBAD
Bacterial Resistance(s): Hyg
Screening: -
Growth Strain(s): DH5alpha
Culture Medium: LB
Temperature: 30 Centigrade
Vector Size: 7660 bp

 

pACBSR-hyg Sequence

GTATGCCAGAGACATCGGGGTCAGGTAGTTTTCAACCAGGTTGTTCGGGATGGTTTTTTTGTTGTTAACGATGAACAGGT
TAGCCAGTTTGTTGAAAGCTTGGTGTTTGAAAGTCTGGGCGCCCCAGGTGATTACCAGGTTACCCAGGTGGTTAACACGT
TCTTTTTTGTGCGGCGGGGACAGTACCCACTGATCGTACAGCAGACATACGTGGTCCATGTATGCTTTGTTTTTCCACTC
GAACTGCATACAGTAGGTTTTACCTTCATCACGAGAACGGATGTAAGCATCACCCAGGATCAGACCGATACCTGCTTCGA
ACTGTTCGATGTTCAGTTCGATCAGCTGGGATTTGTATTCTTTCAGCAGTTTAGAGTTCGGACCCAGGTTCATTACCTGG
TTTTTTTTGATGTTTTTCATATGCATATAGGTACCCTCCTGCTAGCCCAAAAAAACGGGTATGGAGAAACAGTAGAGAGT
TGCGATAAAAAGCGTCAGGTAGGATCCGCTAATCTTATGGATAAAAATGCTATGGCATAGCAAAGTGTGACGCCGTGCAA
ATAATCAATGTGGACTTTTCTGCCGTGATTATAGACACTTTTGTTACGCGTTTTTGTCATGGCTTTGGTCCCGCTTTGTT
ACAGAATGCTTTTAATAAGCGGGGTTACCGGTTTGGTTAGCGAGAAGAGCCAGTAAAAGACGCAGTGACGGCAATGTCTG
ATGCAATATGGACAATTGGTTTCTTCTCTGAATGGCGGGAGTATGAAAAGTATGGCTGAAGCGCAAAATGATCCCCTGCT
GCCGGGATACTCGTTTAATGCCCATCTGGTGGCGGGTTTAACGCCGATTGAGGCCAACGGTTATCTCGATTTTTTTATCG
ACCGACCGCTGGGAATGAAAGGTTATATTCTCAATCTCACCATTCGCGGTCAGGGGGTGGTGAAAAATCAGGGACGAGAA
TTTGTTTGCCGACCGGGTGATATTTTGCTGTTCCCGCCAGGAGAGATTCATCACTACGGTCGTCATCCGGAGGCTCGCGA
ATGGTATCACCAGTGGGTTTACTTTCGTCCGCGCGCCTACTGGCATGAATGGCTTAACTGGCCGTCAATATTTGCCAATA
CGGGGTTCTTTCGCCCGGATGAAGCGCACCAGCCGCATTTCAGCGACCTGTTTGGGCAAATCATTAACGCCGGGCAAGGG
GAAGGGCGCTATTCGGAGCTGCTGGCGATAAATCTGCTTGAGCAATTGTTACTGCGGCGCATGGAAGCGATTAACGAGTC
GCTCCATCCACCGATGGATAATCGGGTACGCGAGGCTTGTCAGTACATCAGCGATCACCTGGCAGACAGCAATTTTGATA
TCGCCAGCGTCGCACAGCATGTTTGCTTGTCGCCGTCGCGTCTGTCACATCTTTTCCGCCAGCAGTTAGGGATTAGCGTC
TTAAGCTGGCGCGAGGACCAACGTATCAGCCAGGCGAAGCTGCTTTTGAGCACCACCCGGATGCCTATCGCCACCGTCGG
TCGCAATGTTGGTTTTGACGATCAACTCTATTTCTCGCGGGTATTTAAAAAATGCACCGGGGCCAGCCCGAGCGAGTTCC
GTGCCGGTTGTGAAGAAAAAGTGAATGATGTAGCCGTCAAGTTGTCATAATTGGTAACGAATCAGACAATTGACGGCTTG
ACGGAGTAGCATAGGGTTTGCAGAATCCCTGCTTCGTCCATTTGACAGGCACATTATGCATCGATGATAAGCTGTCAAAC
ATGAGCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCC
GACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCC
CGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGC
AGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTT
GGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAG
CAGATTGTACTGAGAGTGCACCTGCCATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAAGGGCA
CCAATAACTGCCTTAAAAAAACTCGAGGTATATATGAGTAAACTTGGTCTGACAGCTATTCCTTTGCCCTCGGACGAGTG
CTGGGGCGTCGGTTTCCACTATCGGCGAGTACTTCTACACAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCGATTTG
TGTACGCCCGACAGTCCCGGCTCCGGATCGGACGATTGCGTCGCATCGACCCTGCGCCCAAGCTGCATCATCGAAATTGC
CGTCAACCAAGCTCTGATAGAGTTGGTCAAGACCAATGCGGAGCATATACGCCCGGAGCCGCGGCGATCCTGCAAGCTCC
GGATGCCTCCGCTCGAAGTAGCGCGTCTGCTGCTCCATACAAGCCAACCACGGCCTCCAGAAGAAGATGTTGGCGACCTC
GTATTGGGAATCCCCGAACATCGCCTCGCTCCAGTCAATGACCGCTGTTATGCGGCCATTGTCCGTCAGGACATTGTTGG
AGCCGAAATCCGCGTGCACGAGGTGCCGGACTTCGGGGCAGTCCTCGGCCCAAAGCATCAGCTCATCGAGAGCCTGCGCG
ACGGACGCACTGACGGTGTCGTCCATCACAGTTTGCCAGTGATACACATGGGGATCAGCAATCGCGCATATGAAATCACG
CCATGTAGTGTATTGACCGATTCCTTGCGGTCCGAATGGGCCGAACCCGCTCGTCTGGCTAAGATCGGCCGCAGCGATCG
CATCCATGGCCTCCGCGACCGGCTGCAGAACAGCGGGCAGTTCGGTTTCAGGCAGGTCTTGCAACGTGACACCCTGTGCA
CGGCGGGAGATGCAATAGGTCAGGCTCTCGCTGAATTCCCCAATGTCAAGCACTTCCGGAATCGGGAGCGCGGCCGATGC
AAAGTGCCGATAAACATAACGATCTTTGTAGAAACCATCGGCGCAGCTATTTACCCGCAGGACATATCCACGCCCTCCTA
CATCGAAGCTGAAAGCACGAGATTCTTCGCCCTCCGAGAGCTGCATCAGGTCGGAGACGCTGTCGAACTTTTCGATCAGA
AACTTCTCGACAGACGTCGCGGTGAGTTCAGGCTTTTTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGG
TTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAG
ATCTGCAAAGTGCGTCGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTC
TGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCT
AGCGGAGTGTATACTGGCTTACTATGTTGGCACTGATGAGGGTGTCAGTGAAGTGCTTCATGTGGCAGGAGAAAAAAGGC
TGCACCGGTGCGTCAGCAGAATATGTGATACAGGATATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGTCGTTC
GACTGCGGCGAGCGGAAATGGCTTACGAACGGGGCGGAGATTTCCTGGAAGATGCCAGGAAGATACTTAACAGGGAAGTG
AGAGGGCCGCGGCAAAGCCGTTTTTCCATAGGCTCCGCCCCCCTGACAAGCATCACGAAATCTGACGCTCAAATCAGTGG
TGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCTGCCTT
TCGGTTTACCGGTGTCATTCCGCTGTTATGGCCGCGTTTGTCTCATTCCACGCCTGACACTCAGTTCCGGGTAGGCAGTT
CGCTCCAAGCTGGACTGTATGCACGAACCCCCCGTTCAGTCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTC
CAACCCGGAAAGACATGCAAAAGCACCACTGGCAGCAGCCACTGGTAATTGATTTAGAGGAGTTAGTCTTGAAGTCATGC
GCCGGTTAAGGCTAAACTGAAAGGACAAGTTTTGGTGACTGCGCTCCTCCAAGCCAGTTACCTCGGTTCAAAGAGTTGGT
AGCTCAGAGAACCTTCGAAAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAGCAAGAGATTACGCGCAGACCAAAAC
GATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTTCTAGATTTCAGTGCAATTTATCTCTTCAAATGTAGCACCT
GAAGTCAGCCCCATACGATATAAGTTGTAATTCTCATGTTTGACAGCTTATCATCGGTGCACCCAACTGATCTTCAGCAT
CTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGG
AAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACAT
ATTTGAATGTATTTAGAAAAATAAACAAAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTA
ATTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCGCAACGTTCAAATCCGCTCC
CGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCT
TTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCATGGGGAGACCCCACACTACCATCGGCGCTACGGCGTTTCAC
TTCTGAGTTCGGCATGGGGTCAGGTGGGACCACCGCGCTACTGCCGCCAGGCAAATTCTGTTTTATCAGACCGCTTCTGC
GTTCTGATTTAATCTGTATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACAGCCAAGCTTGCATGCATTCTTCGTCTGT
TTCTACTGGTATTGGCACAAACCTGATTCCAATTTGAGCAAGGCTATGTGCCATCTCGATACTCGTTCTTAACTCAACAG
AAGATGCTTTGTGCATACAGCCCCTCGTTTATTATTTATCTCCTCAGCCAGCCGCTGTGCTTTCAGTGGATTTCGGATAA
CAGAAAGGCCGGGAAATACCCAGCCTCGCTTTGTAACGGAGTAGACGAAAGTGATTGCGCCTACCCGGATATTATCGTGA
GGATGCGTCATCGCCATTGCTCCCCAAATACAAAACCAATTTCAGCCAGTGCCTCGTCCATTTTTTCGATGAACTCCGGC
ACGATCTCGTCAAAACTCGCCATGTACTTTTCATCCCGCTCAATCACGACATAATGCAGGCCTTCACGCTTCATACGCGG
GTCATAGTTGGCAAAGTACCAGGCATTTTTTCGCGTCACCCACATGCTGTACTGCACCTGGGCCATGTAAGCTGACTTTA
TGGCCTCGAAACCACCGAGCCGGAACTTCATGAAATCCCGGGAGGTAAACGGGCATTTCAGTTCAAGGCCGTTGCCGTCA
CTGCATAAACCATCGGGAGAGCAGGCGGTACGCATACTTTCGTCGCGATAGATGATCGGGGATTCAGTAACATTCACGCC
GGAAGTGAATTCAAACAGGGTTCTGGCGTCGTTCTCGTACTGTTTTCCCCAGGCCAGTGCTTTAGCGTTAACTTCCGGAG
CCACACCGGTGCAAACCTCAGCAAGCAGGGTGTGGAAGTAGGACATTTTCATGTCAGGCCACTTCTTTCCGGAGCGGGGT
TTTGCTATCACGTTGTGAACTTCTGAAGCGGTGATGACGCCGAGCCGTAATTTGTGCCACGCATCATCCCCCTGTTCGAC
AGCTCTCACATCGATCCCGGTACGCTGCAGGATAATGTCCGGTGTCATGCTGCCACCTTCTGCTCTGCGGCTTTCTGTTT
CAGGAATCCAAGAGCTTTTACTGCTTCGGCCTGTGTCAGTTCTGACGATGCACGAATGTCGCGGCGAAATATCTGGGAAC
AGAGCGGCAATAAGTCGTCATCCCATGTTTTATCCAGGGCGATCAGCAGAGTGTTAATCTCCTGCATGGTTTCATCGTTA
ACCGGAGTGATGTCGCGTTCCGGCTGACGTTCTGCAGTGTATGCAGTATTTTCGACAATGCGCTCGGCTTCATCCTTGTC
ATAGATACCAGCAAATCCGAAGGCCAGACGGGCACACTGAATCATGGCTTTATGACGTAACATCCGTTTGGGATGCGACT
GCCACGGCCCCGTGATTTCTCTGCCTTCGCGAGTTTTGAATGGTTCGCGGCGGCATTCATCCATCCATTCGGTAACGCAG
ATCGGATGATTACGGTCCTTGCGGTAAATCCGGCATGTACAGGATTCATTGTCCTGCTCAAAGTCCATGCCATCAAACTG
CTGGTTTTCATTGATGATGCGGGACCAGCCATCAACGCCCACCACCGGAACGATGCCATTCTGCTTATCAGGAAAGGCGT
AAATTTCTTTCGTCCACGGATTAAGGCCGTACTGGTTGGCAACGATCAGTAATGCGATGAACTGCGCATCGCTGGCATCA
CCTTTAAATGCCGTCTGGCGAAGAGTGGTGATCAGTTCCTGTGGGTCGACAGAATCCATGCCGACACGTTCAGCCAGCTT
CCCAGCCAGCGTTGCGAGTGCAGTACTCATTCGTTTTATACCTCTGAATCAATATCAACCTGGTGGTGAGCAATGGTTTC
AACCATGTACCGGATGTGTTCTGCCATGCGCTCCTGAAACTCAACATCGTCATCAAACGCACGGGTAATGGATTTTTTGC
TGGCCCCGTGGCGTTGCAAATGATCGATGCATAGCGATTCAAACAGGTGCTGGGGCAGGCCTTTTTCCATGTCGTCTGCC
AGTTCTGCCTCTTTCTCTTCACGGGCGAGCTGCTGGTAGTGACGCGCCCAGCTCTGAGCCTCAAGACGATCCTGAATGTA
ATAAGCGTTCATGGCTGAACTCCTGAAATAGCTGTGAAAATATCGCCCGCGAAATGCCGGGCTGATTAGGAAAACAGGAA
AGGGGGTTAGTGAATGCTTTTGCTTGATCTCAGTTTCAGTATTAATATCCATTTTTTATAACCTCCTTAGCATGCCTGCA
GACGTCGGGCCCTTATTTCAGGAAAGTTTCGGAGGAGATAGTGTTCGGCAGTTTGTACATCATCTGCGGGATCAGGTACG
GTTTGATCAGGTTGTAGAAGATCAGGTAAGACATAGAATCGATGTAGATGATCGGTTTGTTTTTGTTGATTTTTACGTAA
CAGTTCAGTTGGAATTTGTTACGCAGACCCTTAACCAGGTATTCTACTTCTTCGAAAGTGAAAGACTGGGTGTTCAGTAC
GATCGATTTGTTGGTAGAGTTTTTGTTGTAATCCCATTTACCACCATCATCCATGAACCA
//

 

*Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart