pAcGFP1- 1 Plasmid


  • Model: PVT1210
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pAcGFP1-1,Plasmid pAcGFP1-1,pAcGFP1-1 vector



pAcGFP1-1 Informaiton

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation serial plasmids; lactating fluorescent plasmid; lactation green plasmid

Plasmid size: 4150bp

Plasmid tagging: C-AcGFP1

Prokaryotic resistance: kanamycin Kan (50 g/ml)

Screening marker: neomycin Neo/G418

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, aerobic LB

Expression host: mammalian cells such as 293T

Induction mode: no need to induce, transient expression.

5'sequencing primers: AcGFP-1-F (GCGTCGATTTTTGTGATGCTC)

3'sequencing primers: Sv40-polyA-R (GAAATTTGTGATGCTATTGC)

Remarks: mammalian cell promoter detection vector


pAcGFP1-1 Description

pAcGFP1-1 encodes the green fuorescent protein AcGFP1, a derivative of AcGFP from Aequorea coerulescens. AcGFP1 has been optimized for brighter fuorescence. (Excitation maximum = 475 nm; emission maximum = 505 nm.) The coding sequence of the AcGFP1 gene contains silent base changes, which correspond to human codon-usage preferences . pAcGFP1-1 is a promoterless vector that can be used to monitor transcription from different promoters and promoter/enhancer combinations inserted into the multiple cloning site (MCS). Sequences upstream of AcGFP1 have been converted to a Kozak consensus translation initiation site (2) to enhance translation effciency in eukaryotic cells. SV40 polyadenylation signals downstream of the AcGFP1 gene direct proper processing of the 3' end of the AcGFP1 mRNA. The vector backbone contains an SV40 origin for replication in mammalian cells expressing the SV40 T antigen, a pUC origin of replication for propagation in E. coli, and an f1 origin for single-stranded DNA production. A neomycin-resistance cassette (Neor) allows stably transfected eukaryotic cells to be selected using G418. This cassette consists of the SV40 early promoter, the neomycin/kanamycin resistance gene of Tn5, and polyadenylation signals from the Herpes simplex virus thymidine kinase (HSV TK) gene. A bacterial promoter upstream of the cassette expresses kanamycin resistance in E. coli.


pAcGFP1-1 Multiple cloning site




pAcGFP1-1 Sequence

LOCUS       Exported                4150 bp ds-DNA    circular SYN 18-10-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4150)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-10-18  
FEATURES             Location/Qualifiers
     source          1..4150
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    12..89
                     /note="multiple cloning site"
     CDS             97..816
                     /product="Aequorea coerulescens GFP"
                     /note="mammalian codon-optimized"
     polyA_signal    938..1059
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1066..1521)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        1548..1652
                     /note="AmpR promoter"
     promoter        1654..2011
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      1862..1997
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2046..2840
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    3072..3119
                     /note="HSV TK poly(A) signal"
                     /note="herpesvirus thymidine kinase polyadenylation signal"
     rep_origin      3448..4036
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tagttattac tagcgctacc ggactcagat ctcgagctca agcttcgaat tctgcagtcg
       61 acggtaccgc gggcccggga tccaccggtc gccaccatgg tgagcaaggg cgccgagctg
      121 ttcaccggca tcgtgcccat cctgatcgag ctgaatggcg atgtgaatgg ccacaagttc
      181 agcgtgagcg gcgagggcga gggcgatgcc acctacggca agctgaccct gaagttcatc
      241 tgcaccaccg gcaagctgcc tgtgccctgg cccaccctgg tgaccaccct gagctacggc
      301 gtgcagtgct tctcacgcta ccccgatcac atgaagcagc acgacttctt caagagcgcc
      361 atgcctgagg gctacatcca ggagcgcacc atcttcttcg aggatgacgg caactacaag
      421 tcgcgcgccg aggtgaagtt cgagggcgat accctggtga atcgcatcga gctgaccggc
      481 accgatttca aggaggatgg caacatcctg ggcaataaga tggagtacaa ctacaacgcc
      541 cacaatgtgt acatcatgac cgacaaggcc aagaatggca tcaaggtgaa cttcaagatc
      601 cgccacaaca tcgaggatgg cagcgtgcag ctggccgacc actaccagca gaataccccc
      661 atcggcgatg gccctgtgct gctgcccgat aaccactacc tgtccaccca gagcgccctg
      721 tccaaggacc ccaacgagaa gcgcgatcac atgatctact tcggcttcgt gaccgccgcc
      781 gccatcaccc acggcatgga tgagctgtac aagtgagcgg ccgcgactct agatcataat
      841 cagccatacc acatttgtag aggttttact tgctttaaaa aacctcccac acctccccct
      901 gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa
      961 tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca
     1021 ttctagttgt ggtttgtcca aactcatcaa tgtatcttaa ggcgtaaatt gtaagcgtta
     1081 atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg
     1141 ccgaaatcgg caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg
     1201 ttccagtttg gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa
     1261 aaaccgtcta tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg
     1321 ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt
     1381 gacggggaaa gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg
     1441 ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta
     1501 atgcgccgct acagggcgcg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta
     1561 tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat
     1621 aaatgcttca ataatattga aaaaggaaga gtcctgaggc ggaaagaacc agctgtggaa
     1681 tgtgtgtcag ttagggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag
     1741 catgcatctc aattagtcag caaccaggtg tggaaagtcc ccaggctccc cagcaggcag
     1801 aagtatgcaa agcatgcatc tcaattagtc agcaaccata gtcccgcccc taactccgcc
     1861 catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct gactaatttt
     1921 ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga agtagtgagg
     1981 aggctttttt ggaggcctag gcttttgcaa agatcgatca agagacagga tgaggatcgt
     2041 ttcgcatgat tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc
     2101 tattcggcta tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc
     2161 tgtcagcgca ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
