pACT- MyoD Plasmid

$182.00

  • Model: PVT1704
  • 50 Units in Stock
Ask a question


Add to Cart:

pACT-MyoD

Search name

pACT-MyoD,Plasmid pACT-MyoD,pACT-MyoD vector

 

pACT-MyoD Information

Promoter: T7, CMV
Replicator: pUC ori, F1 ori
Terminator: SV40 poly (A) signal
Plasmid classification: mammalian cells, mammalian two hybrid carriers
Plasmid size: 7400bp
Prokaryotic resistance: Amp
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, instantaneous expression
5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG
3'sequencing primers: primers designed according to sequence

 

pACT-MyoD Description

The CheckMate Mammalian Two-Hybrid System provides positive control vectors that encode and express two proteins known to interact in vivo (13). MyoD is expressed in skeletal muscle and is a myogenic regulatory protein (14,15). The Id protein acts as a negative regulator of myogenic differentiation (16). MyoD and Id are members of the helix-loop-helix family of nuclear proteins. The pBIND-Id Control Vector contains a segment of murine Id cDNA (amino acids 29–148; 13,16) cloned in-frame with the GAL4 DNA-binding domain of the pBIND Vector . The pACT-MyoD Control Vector contains a segment of murine MyoD cDNA (amino acids 1–318; 13,15) cloned in-frame with the VP16 activation domain of the pACT Vector .

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart