pACT Plasmid

$182.00

  • Model: PVT1703
  • 50 Units in Stock
Ask a question


Add to Cart:

pACT

Search name

pACT ,Plasmid pACT ,pACT vector

 

 

pACT Information

Promoter: T7, T3, CMV

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid Classification: Mammalian Cells, Mammalian Cell Two-hybrid Vectors

Plasmid size: 5566bp

Prokaryotic resistance: Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, transient expression

5'Sequencing Primers: CMV-F: CGCAAATGGGGGGGTAGGGGGGTG

3'Sequencing Primers: Designing Primers Based on Sequences

 

pACT Description

The pACT Vector is a high-copy plasmid in which the human cytomegalovirus (CMV) immediate early promoter drives expression of the herpes virus VP16activation domain (amino acids 411–456). A chimeric intron is located 5´ of the gene segment, and a multiple cloning region is located 3´ of the gene segment for insertion of cDNA clones of interest . The presence of this chimeric intron, in context with the CMV promoter and polyadenylation signal, can result in increased protein expression of cDNA genes linked to these elements. The stop codons and SV40 late polyadenylation region, demonstrated to be efficient for mRNA production , are at the 3´ end of the fusion gene. The fusion gene region is flanked by T7 and T3 RNA polymerase promoters for the synthesis of sense and antisense RNA products. The T7 promoter allows the construct to be translated using the TNT® T7 Quick Coupled Transcription/Translation System (Cat.). Also located on this vector is the neomycin phosphotransferase gene (from Tn5) driven by the SV40 early promoter and followed by a synthetic polyadenylation cassette. This gene confers resistance to the neomycin analog, G418 . The plasmid backbone contains an f1 origin of replication for the production of single-stranded DNA (ssDNA) and the β-lactamase (Ampr) gene for selection of the vector DNA in E. coli.

 

pACT Multiple cloning sites

pACT-vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart