pAD123 Plasmid


  • Model: PVT5014
  • 50 Units in Stock
Ask a question

Add to Cart:

pAD123 Plasmid

PVT5014     2ug


pAD123 plasmid information

Replicon: ori
Plasmid classification: subtilis series plasmid; subtilis integrated plasmid; Bacillus subtilis intracellular plasmid
Plasmid size: 5952bp
Plasmid Tags: C-GFP
Prokaryotic resistance: ampicillin Amp (100 g/ml)
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 37 LB, aerobic
Host: Bacillus subtilis
Primers for 5'sequencing: Amp-F (GGGTTATTGTCTCATGAGCGG)
Report: Bacillus subtilis promoter reporter plasmid


pAD123 plasmid Descrription

We constructed a promoter-trap plasmid, pAD123, for Bacillus cereus. This plasmid contains a promoterless gene that encodesa mutant version of the green fluorescent protein, GFPmut3a, that is optimized for fluorescence-activated cell sorting [Cormack, FACS-optimized mutants of the green fluorescent protein (GFP).

pAD123 plasmid Sequence

LOCUS       Exported File           5952 bp ds-DNA    circular SYN 29-5-2015

KEYWORDS    Untitled

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 5952)

  TITLE     Direct Submission

  JOURNAL   Exported 2015-5-29

FEATURES             Location/Qualifiers

     source          1..5952

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             54..770


                     /product="Aequoria victoria green fluorescent protein"







     misc_feature    3802..3942


                     /note="basis of mobility region from pBR322"

     rep_origin      complement(4128..4716)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(4887..5747)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(5748..5852)


                     /note="AmpR promoter"


        1 gaattcgagc tcggtacccg gggatcctct agatttaaga aggagatata catatgagta

       61 aaggagaaga acttttcact ggagttgtcc caattcttgt tgaattagat ggtgatgtta

      121 atgggcacaa attttctgtc agtggagagg gtgaaggtga tgcaacatac ggaaaactta

      181 cccttaaatt tatttgcact actggaaaac tacctgttcc atggccaaca cttgtcacta

      241 ctttcgggta tggtgttcaa tgctttgcga gatacccaga tcatatgaaa cagcatgact

      301 ttttcaagag tgccatgccc gaaggttatg tacaggaaag aactatattt ttcaaagatg

      361 acgggaacta caagacacgt gctgaagtca agtttgaagg tgataccctt gttaatagaa

      421 tcgagttaaa aggtattgat tttaaagaag atggaaacat tcttggacac aaattggaat

      481 acaactataa ctcacacaat gtatacatca tggcagacaa acaaaagaat ggaatcaaag

      541 ttaacttcaa aattagacac aacattgaag atggaagcgt tcaactagca gaccattatc

      601 aacaaaatac tccaattggc gatggccctg tccttttacc agacaaccat tacctgtcca

      661 cacaatctgc cctttcgaaa gatcccaacg aaaagagaga ccacatggtc cttcttgagt

      721 ttgtaacagc tgctgggatt acacatggca tggatgaact atacaaataa atctcctgca

      781 ggcatgcaag cttgagtagg acaaatccgc cgagcttcga cgagattttc aggagctaag

      841 gaagctaaaa tggagaaaaa aatcactgga tataccaccg ttgatatatc ccaatggcat

      901 cgtaaagaac attttgaggc atttcagtca gttgctcaat gtacctataa ccagaccgtt

      961 cagaacaaag aatacaagaa aatatttaca aaaaatcaat ttaacaattc cttaaaacat

     1021 gcaggaattg acgatttaaa caatattagc tttgaacaat tcttatctct tttcaatagc

     1081 tataaattat ttaataagta agttaaggga tgcataaact gcatccctta acttgttttt

     1141 cgtgtgccta ttttttgtga atcgctaaga aaccattatt atcatgacat taacctataa

     1201 aaataggcgt atcacgaggc cctttcgtct cgcgcgtttc ggtgatgacg gtgaaaacct

     1261 ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag

     1321 acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggctggc ttaactatgc

     1381 ggcatcagag cagattgtac tgagagtgca ccatacaaaa catatttcaa cacaatacaa

     1441 atgggttagt taaaaaagca ggccttctaa aggtctgctt tttttatttg attatgtaat

     1501 ttttaatgcc aggatgccaa taagccataa cctcaaatgc accatttgca acctcgtcat

     1561 cttcttcctc aatcttgacc agatcgccgt cctccgcatc accaagattc agctctttat

     1621 gtatctcctt caaaatgcca ccgtatccaa ttaaccttcg agctgccaac gcatcatcca

     1681 agtaaagcac cgtgttcaga ttgtcttcag tcaccttatt accgcgcaca caatccgtat

     1741 ccttaaccgg atatttagag atttcgcgaa cagctttttg ctccatcatt gcgttccgca

     1801 catcgttttc aatctgttca gcgtcaatct tagctttacc tttcactcga cgaatatcga

     1861 caattggagt gtaatccaat ttcatcgcct ttttccaaag gctcgtccac tccgcctgct

     1921 taatatagtt tttcccaaaa taatttttcc ttactggtat caacacatga aaatgaggat

     1981 gatatgtatc ttcttcatga tttttggtaa tctctaaagc tctgaaaaat ccaagaaccg

     2041 aagtttttac ttttttgtac tggaacagtt tcctaaagcc ttccatcatc gcagaaattt

     2101 gtggcttcag ccgttctccc tttacatttc gaatcgtcag cgtgagaaaa atccatccgc

     2161 agccgtactg tctattggct tcctctacga tcaacttatt gtgataagca atttttaacg

     2221 acctgcgcca cgcacacatc ggacataacc tcactttaca aaaatgggct tgatacagtt

     2281 ttaacttgcc cgtctccggg tctctcttaa acgaaagata ctctgcacaa ctaattagtt

     2341 tttcagcctt tttgccatag taaggtgccc caatcttact ctctaacgct tcgtaatgct

     2401 ccgccatgag gttcgtccgt ctctttttcc ccttccaatc ccgcttttta cctgttgcgg

     2461 ttttatcttc gaggatgcta taatcatttt cagatgaata aatcaacaaa aaaactcctt

     2521 ctgagctagt tctctagcat tctattattt tgattcgaca ccttaataat agcagaagga

     2581 gtttttacct gtcaaagaac catcaaaccc ttgatacaca aggctttgac ctaattttga

     2641 aaaatgatgt tgtttctata tagtatcaag ataagaaaga aaaggatttt tcgctacgct

     2701 caaatccttt aaaaaaacac aaaagaccac attttttaat gtggtcttta ttcttcaact

     2761 aaagcaccca ttagttcaac aaacgaaaat tggataaagt gggatatttt taaaatatat

     2821 atttatgtta cagtaatatt gacttttaaa aaaggattga ttctaatgaa gaaagcagac

     2881 aagtaagcct cctaaattca ctttagataa aaatttagga ggcatatcaa atgaacttta

     2941 ataaaattga tttagacaat tggaagagaa aagagatatt taatcattat ttgaaccaac

     3001 aaacgacttt tagtataacc acagaaattg atattagtgt tttataccga aacataaaac

     3061 aagaaggata taaattttac cctgcattta ttttcttagt gacaagggtg ataaactcaa

     3121 atacagcttt tagaactggt tacaatagcg acggagagtt aggttattgg gataagttag

     3181 agccacttta tacaattttt gatggtgtat ctaaaacatt ctctggtatt tggactcctg

     3241 taaagaatga cttcaaagag ttttatgatt tatacctttc tgatgtagag aaatataatg

     3301 gttcggggaa attgtttccc aaaacaccta tacctgaaaa tgctttttct ctttctatta

     3361 ttccatggac ttcatttact gggtttaact taaatatcaa taataatagt aattaccttc

     3421 tacccattat tacagcagga aaattcatta ataaaggtaa ttcaatatat ttaccgctat

     3481 ctttacaggt acatcattct gtttgtgatg gttatcatgc aggattgttt atgaactcta

     3541 ttcaggaatt gtcagatagg cctaatgact ggcttttata atatgagata atgccgactg

     3601 tactttttac agtcggtttt ctaatgtcac taacctgccc cgttagtcgc cattcgccag

     3661 ctgcctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac

     3721 ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc

     3781 gggtgttggc gggtgtcggg gcgcagccat gacccagtca cgtagcgata gcggagtgta

     3841 tactggctta actatgcggc atcagagcag attgtactga gagtgcacca tatgcggtgt

     3901 gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgctcttc cgcttcctcg

     3961 ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag

     4021 gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa

     4081 ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc

     4141 cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca

     4201 ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg

     4261 accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct

     4321 caatgctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt

     4381 gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag

     4441 tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc

     4501 agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac

     4561 actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga

     4621 gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc

     4681 aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg

     4741 gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca

     4801 aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt

     4861 atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca

     4921 gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg

     4981 atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca

     5041 ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt

     5101 cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt

     5161 agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctgcaggcat cgtggtgtca

     5221 cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca

     5281 tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga

     5341 agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact

     5401 gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga

     5461 gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caacacggga taataccgcg

     5521 ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc

     5581 tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga

     5641 tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat

     5701 gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt

     5761 caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt

     5821 atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac

     5881 gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat cacgaggccc

     5941 tttcgtcttc aa



Product is for research use only!


Search name

pAD123,Plasmid pAD123,pAD123 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
