pAD123 Plasmid


  • Model: PVT5014
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pAD123,Plasmid pAD123,pAD123 vector

pAD123 plasmid information

Replicon: ori
Plasmid classification: subtilis series plasmid; subtilis integrated plasmid; Bacillus subtilis intracellular plasmid
Plasmid size: 5952bp
Plasmid Tags: C-GFP
Prokaryotic resistance: ampicillin Amp (100 g/ml)
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 37 LB, aerobic
Host: Bacillus subtilis
Primers for 5'sequencing: Amp-F (GGGTTATTGTCTCATGAGCGG)
Report: Bacillus subtilis promoter reporter plasmid


pAD123 plasmid Descrription

We constructed a promoter-trap plasmid, pAD123, for Bacillus cereus. This plasmid contains a promoterless gene that encodesa mutant version of the green fluorescent protein, GFPmut3a, that is optimized for fluorescence-activated cell sorting [Cormack, FACS-optimized mutants of the green fluorescent protein (GFP).

pAD123 plasmid Sequence

LOCUS       Exported File           5952 bp ds-DNA    circular SYN 29-5-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5952)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-5-29 
FEATURES             Location/Qualifiers
     source          1..5952
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             54..770
                     /product="Aequoria victoria green fluorescent protein"
     misc_feature    3802..3942
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(4128..4716)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(4887..5747)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(5748..5852)
                     /note="AmpR promoter"
        1 gaattcgagc tcggtacccg gggatcctct agatttaaga aggagatata catatgagta
       61 aaggagaaga acttttcact ggagttgtcc caattcttgt tgaattagat ggtgatgtta
      121 atgggcacaa attttctgtc agtggagagg gtgaaggtga tgcaacatac ggaaaactta
      181 cccttaaatt tatttgcact actggaaaac tacctgttcc atggccaaca cttgtcacta
      241 ctttcgggta tggtgttcaa tgctttgcga gatacccaga tcatatgaaa cagcatgact
      301 ttttcaagag tgccatgccc gaaggttatg tacaggaaag aactatattt ttcaaagatg
      361 acgggaacta caagacacgt gctgaagtca agtttgaagg tgataccctt gttaatagaa
      421 tcgagttaaa aggtattgat tttaaagaag atggaaacat tcttggacac aaattggaat
      481 acaactataa ctcacacaat gtatacatca tggcagacaa acaaaagaat ggaatcaaag
      541 ttaacttcaa aattagacac aacattgaag atggaagcgt tcaactagca gaccattatc
      601 aacaaaatac tccaattggc gatggccctg tccttttacc agacaaccat tacctgtcca
      661 cacaatctgc cctttcgaaa gatcccaacg aaaagagaga ccacatggtc cttcttgagt
      721 ttgtaacagc tgctgggatt acacatggca tggatgaact atacaaataa atctcctgca
      781 ggcatgcaag cttgagtagg acaaatccgc cgagcttcga cgagattttc aggagctaag
      841 gaagctaaaa tggagaaaaa aatcactgga tataccaccg ttgatatatc ccaatggcat
      901 cgtaaagaac attttgaggc atttcagtca gttgctcaat gtacctataa ccagaccgtt
      961 cagaacaaag aatacaagaa aatatttaca aaaaatcaat ttaacaattc cttaaaacat
     1021 gcaggaattg acgatttaaa caatattagc tttgaacaat tcttatctct tttcaatagc
     1081 tataaattat ttaataagta agttaaggga tgcataaact gcatccctta acttgttttt
     1141 cgtgtgccta ttttttgtga atcgctaaga aaccattatt atcatgacat taacctataa
     1201 aaataggcgt atcacgaggc cctttcgtct cgcgcgtttc ggtgatgacg gtgaaaacct
     1261 ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag
     1321 acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggctggc ttaactatgc
     1381 ggcatcagag cagattgtac tgagagtgca ccatacaaaa catatttcaa cacaatacaa
     1441 atgggttagt taaaaaagca ggccttctaa aggtctgctt tttttatttg attatgtaat
     1501 ttttaatgcc aggatgccaa taagccataa cctcaaatgc accatttgca acctcgtcat
     1561 cttcttcctc aatcttgacc agatcgccgt cctccgcatc accaagattc agctctttat
     1621 gtatctcctt caaaatgcca ccgtatccaa ttaaccttcg agctgccaac gcatcatcca
     1681 agtaaagcac cgtgttcaga ttgtcttcag tcaccttatt accgcgcaca caatccgtat
     1741 ccttaaccgg atatttagag atttcgcgaa cagctttttg ctccatcatt gcgttccgca
     1801 catcgttttc aatctgttca gcgtcaatct tagctttacc tttcactcga cgaatatcga
     1861 caattggagt gtaatccaat ttcatcgcct ttttccaaag gctcgtccac tccgcctgct
     1921 taatatagtt tttcccaaaa taatttttcc ttactggtat caacacatga aaatgaggat
     1981 gatatgtatc ttcttcatga tttttggtaa tctctaaagc tctgaaaaat ccaagaaccg
     2041 aagtttttac ttttttgtac tggaacagtt tcctaaagcc ttccatcatc gcagaaattt
     2101 gtggcttcag ccgttctccc tttacatttc gaatcgtcag cgtgagaaaa atccatccgc
     2161 agccgtactg tctattggct tcctctacga tcaacttatt gtgataagca atttttaacg
     2221 acctgcgcca cgcacacatc ggacataacc tcactttaca aaaatgggct tgatacagtt
     2281 ttaacttgcc cgtctccggg tctctcttaa acgaaagata ctctgcacaa ctaattagtt
     2341 tttcagcctt tttgccatag taaggtgccc caatcttact ctctaacgct tcgtaatgct
     2401 ccgccatgag gttcgtccgt ctctttttcc ccttccaatc ccgcttttta cctgttgcgg
     2461 ttttatcttc gaggatgcta taatcatttt cagatgaata aatcaacaaa aaaactcctt
     2521 ctgagctagt tctctagcat tctattattt tgattcgaca ccttaataat agcagaagga
     2581 gtttttacct gtcaaagaac catcaaaccc ttgatacaca aggctttgac ctaattttga
     2641 aaaatgatgt tgtttctata tagtatcaag ataagaaaga aaaggatttt tcgctacgct
     2701 caaatccttt aaaaaaacac aaaagaccac attttttaat gtggtcttta ttcttcaact
     2761 aaagcaccca ttagttcaac aaacgaaaat tggataaagt gggatatttt taaaatatat
     2821 atttatgtta cagtaatatt gacttttaaa aaaggattga ttctaatgaa gaaagcagac
     2881 aagtaagcct cctaaattca ctttagataa aaatttagga ggcatatcaa atgaacttta
     2941 ataaaattga tttagacaat tggaagagaa aagagatatt taatcattat ttgaaccaac
     3001 aaacgacttt tagtataacc acagaaattg atattagtgt tttataccga aacataaaac
     3061 aagaaggata taaattttac cctgcattta ttttcttagt gacaagggtg ataaactcaa
     3121 atacagcttt tagaactggt tacaatagcg acggagagtt aggttattgg gataagttag
     3181 agccacttta tacaattttt gatggtgtat ctaaaacatt ctctggtatt tggactcctg
     3241 taaagaatga cttcaaagag ttttatgatt tatacctttc tgatgtagag aaatataatg
     3301 gttcggggaa attgtttccc aaaacaccta tacctgaaaa tgctttttct ctttctatta
     3361 ttccatggac ttcatttact gggtttaact taaatatcaa taataatagt aattaccttc
     3421 tacccattat tacagcagga aaattcatta ataaaggtaa ttcaatatat ttaccgctat
     3481 ctttacaggt acatcattct gtttgtgatg gttatcatgc aggattgttt atgaactcta
     3541 ttcaggaatt gtcagatagg cctaatgact ggcttttata atatgagata atgccgactg
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
