pAdDeltaF6

$280.00

  • Model: PVT20760
  • 19 Units in Stock
Ask a question


Add to Cart:

pAdDeltaF6

PVT20760    2ug

 

pAdDeltaF6 Information

Product Name:pAdDeltaF6
Replicon: pUC
Prokaryotic resistance: Amp
Growth Strain(s): DH5a
Host: Adeno associated virus
Vector type: Virus packaging
Fragment type: ORF
species: virus
Prokaryotic resistance: Amp
Resistance Marker:
Fluorescent labeling:

 

pAdDeltaF6 Sequence

TCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTG
GAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAA
ATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGC
TAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGG
CCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTC
GGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAAC
ATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCC
TGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCC
CTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGC
GTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGA
ACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGC
CACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCT
AACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAG
CTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAG
GATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTC
ATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGA
GTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAG
TTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGA
GACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAAC
TTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACG
TTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCA
AGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTT
GGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTG
TGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGG
GATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGAT
CTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCG
TTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATA
CTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAA
AAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACAT
TAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGATAAGCT
TTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCA
TCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTC
CATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCT
CGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCA
TGGCGACCACACCCGTCCTGTGGATCCGGCGCACACCAAAAACGTCACTTTTGCCACATCCGTCGCTTACATGTGTTCCG
CCACACTTGCAACATCACACTTCCGCCACACTACTACGTCACCCGCCCCGTTCCCACGCCCCGCGCCACGTCACAAACTC
CACCCCCTCATTATCATATTGGCTTCAATCCAAAATAATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGAT
AATGAGGGGGTGGAGTTTGTGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACGTAGGTTTTAGGGCGGAGTAACTTG
TATGTGTTGGGAATTGTAGTTTTCTTAAAATGGGAAGTGACGTAACGTGGGAAAACGGAAGTGACGATTTGAGGAAGTTG
TGGGTTTTTTGGCTTTCGTTTCTGGGCGTAGGTTCGCGTGCGGTTTTCTGGGTGTTTTTTGTGGACTTTAACCGTTACGT
CATTTTTTAGTCCTATATATACTCGCTCTGCACTTGGCCCTTTTTTACACTGTGACTGATTGAGCTGGTGCCGTGTCGAG
TGGTGTTTTTTTAATAGGTTTTCTTTTTTACTGGTAAGGCTGACTGTTATGGCTGCCGCTGTGGAAGCGCTGTATGTTGT
TCTGGAGCGGGAGGGTGCTATTTTGCCTAGGCAGGAGGGTTTTTCAGGTGTTTATGTGTTTTTCTCTCCTATTAATTTTG
TTATACCTCCTATGGGGGCTGTAATGTTGTCTCTACGCCTGCGGGTATGTATTCCCCCGGGCTATTTCGGTCGCTTTTTA
GCACTGACCGATGTGAATCAACCTGATGTGTTTACCGAGTCTTACATTATGACTCCGGACATGACCGAGGAGCTGTCGGT
GGTGCTTTTTAATCACGGTGACCAGTTTTTTTACGGTCACGCCGGCATGGCCGTAGTCCGTCTTATGCTTATAAGGGTTG
TTTTTCCTGTTGTAAGACAGGCTTCTAATGTTTAAATGTTTTTTTGTTATTTTATTTTGTGTTTATGCAGAAACCCGCAG
ACATGTTTGAGAGAAAAATGGTGTCTTTTTCTGTGGTGGTTCCGGAGCTTACCTGCCTTTATCTGCATGAGCATGACTAC
GATGTGCTTTCTTTTTTGCGCGAGGCTTTGCCTGATTTTTTGAGCAGCACCTTGCATTTTATATCGCCGCCCATGCAACA
AGCTTACATCGGGGCTACGCTGGTTAGCATAGCTCCGAGTATGCGTGTCATAATCAGTGTGGGTTCTTTTGTCATGGTTC
CTGGCGGGGAAGTGGCCGCGCTGGTCCGTGCAGACCTGCACGATTATGTTCAGCTGGCCCTGCGAAGGGACCTACGGGAT
CGCGGTATTTTTGTTAATGTTCCGCTTTTGAATCTTATACAGGTCTGTGAGGAACCTGAATTTTTGCAATCATGATTCGC
TGCTTGAGGCTGAAGGTGGAGGGCGCTCTGGAGCAGATTTTTACAATGGCCGGACTTAATATTCGGGATTTGCTTAGAGA
TATATTGAGAAGGTGGCGAGATGAGAATTATTTGGGCATGGTTGAAGGTGCTGGAATGTTTATAGAGGAGATTCACCCTG
AAGGGTTTAGCCTTTACGTCCACTTGGACGTGAGGGCCGTTTGCCTTTTGGAAGCCATTGTGCAACATCTTACAAATGCC
ATTATCTGTTCTTTGGCTGTAGAGTTTGACCACGCCACCGGAGGGGAGCGCGTTCACTTAATAGATCTTCATTTTGAGGT
TTTGGATAATCTTTTGGAATAAAAAAAAAAACATGGTTCTTCCAGCTCTTCCCGCTCCTCCCGTGTGTGACTCGCAGAAC
GAATGTGTAGGTTGGCTGGGTGTGGCTTATTCTGCGGTGGTGGATGTTATCAGGGCAGCGGCGCATGAAGGAGTTTACAT
AGAACCCGAAGCCAGGGGGCGCCTGGATGCTTTGAGAGAGTGGATATACTACAACTACTACACAGAGCGATCTAAGCGGC
GAGACCGGAGACGCAGATCTGTTTGTCACGCCCGCACCTGGTTTTGCTTCAGGAAATATGACTACGTCCGGCGTTCCATT
TGGCATGACACTACGACCAACACGATCTCGGTTGTCTCGGCGCACTCCGTACAGTAGGGATCGTCTACCTCCTTTTGAGA
CAGAAACCCGCGCTACCATACTGGAGGATCATCCGCTGCTGCCCGAATGTAACACTTTGACAATGCACAACGTGAGTTAC
GTGCGAGGTCTTCCCTGCAGTGTGGGATTTACGCTGATTCAGGAATGGGTTGTTCCCTGGGATATGGTTCTAACGCGGGA
GGAGCTTGTAATCCTGAGGAAGTGTATGCACGTGTGCCTGTGTTGTGCCAACATTGATATCATGACGAGCATGATGATCC
ATGGTTACGAGTCCTGGGCTCTCCACTGTCATTGTTCCAGTCCCGGTTCCCTGCAGTGTATAGCCGGCGGGCAGGTTTTG
GCCAGCTGGTTTAGGATGGTGGTGGATGGCGCCATGTTTAATCAGAGGTTTATATGGTACCGGGAGGTGGTGAATTACAA
CATGCCAAAAGAGGTAATGTTTATGTCCAGCGTGTTTATGAGGGGTCGCCACTTAATCTACCTGCGCTTGTGGTATGATG
GCCACGTGGGTTCTGTGGTCCCCGCCATGAGCTTTGGATACAGCGCCTTGCACTGTGGGATTTTGAACAATATTGTGGTG
CTGTGCTGCAGTTACTGTGCTGATTTAAGTGAGATCAGGGTGCGCTGCTGTGCCCGGAGGACAAGGCGCCTTATGCTGCG
GGCGGTGCGAATCATCGCTGAGGAGACCACTGCCATGTTGTATTCCTGCAGGACGGAGCGGCGGCGGCAGCAGTTTATTC
GCGCGCTGCTGCAGCACCACCGCCCTATCCTGATGCACGATTATGACTCTACCCCCATGTAGGCGTGGACTTCTCCTTCG
CCGCCCGTTAAGCAACCGCAAGTTGGACAGCAGCCTGTGGCTCAGCAGCTGGACAGCGACATGAACTTAAGTGAGCTGCC
CGGGGAGTTTATTAATATCACTGATGAGCGTTTGGCTCGACAGGAAACCGTGTGGAATATAACACCTAAGAATATGTCTG
TTACCCATGATATGATGCTTTTTAAGGCCAGCCGGGGAGAAAGGACTGTGTACTCTGTGTGTTGGGAGGGAGGTGGCAGG
TTGAATACTAGGGTTCTGTGAGTTTGATTAAGGTACGGTGATCTGTATAAGCTATGTGGTGGTGGGGCTATACTACTGAA
TGAAAAATGACTTGAAATTTTCTGCAATTGAAAAATAAACACGTTGAAACATAACACAAACGATTCTTTATTCTTGGGCA
ATGTATGAAAAAGTGTAAGAGGATGTGGCAAATATTTCATTAATGTAGTTGTGGCCAGACCAGTCCCATGAAAATGACAT
AGAGTATGCACTTGGAGTTGTGTCTCCTGTTTCCTGTGTACCGTTTAGTGTAATGGTTAGTGTTACAGGTTTAGTTTTGT
CTCCGTTTAAGTAAACTTGACTGACAATGTTACTTTTGGCAGTTTTACCGTGAGATTTTGGATAAGCTGATAGGTTAGGC
ATAAATCCAACAGCGTTTGTATAGGCTGTGCCTTCAGTAAGATCTCCATTTCTAAAGTTCCAATATTCTGGGTCCAGGAA
GGAATTGTTTAGTAGCACTCCATTTTCGTCAAATCTTATAATAAGATGAGCACTTTGAACTGTTCCAGATATTGGAGCCA
AACTGCCTTTAACAGCCAAAACTGAAACTGTAGCAAGTATTTGACTGCCACATTTTGTTAAGACCAAAGTGAGTTTAGCA
TCTTTCTCTGCATTTAGTCTACAGTTAGGAGATGGAGCTGGTGTGGTCCACAAAGTTAGCTTATCATTATTTTTGTTTCC
TACTGTAATGGCACCTGTGCTGTCAAAACTAAGGCCAGTTCCTAGTTTAGGAACCATAGCCTTGTTTGAATCAAATTCTA
GGCCATGGCCAATTTTTGTTTTGAGGGGATTTGTGTTTGGTGCATTAGGTGAACCAAATTCAAGCCCATCTCCTGCATTA
ATGGCTATGGCTGTAGCGTCAAACATCAACCCCTTGGCAGTGCTTAGGTTAACCTCAAGCTTTTTGGAATTGTTTGAAGC
TGTAAACAAGTAAAGGCCTTTGTTGTAGTTAATATCCAAGTTGTGGGCTGAGTTTATAAAAAGAGGGCCCTGTCCTAGTC
TTAGATTTAGTTGGTTTTGAGCATCAAACGGATAACTAACATCAAGTATAAGGCGTCTGTTTTGAGAATCAATCCTTAGT
CCTCCTGCTACATTAAGTTGCATATTGCCTTGTGAATCAAAACCCAAGGCTCCAGTAACTTTAGTTTGCAAGGAAGTATT
ATTAATAGTCACACCTGGACCAGTTGCTACGGTCAAAGTGTTTAGGTCGTCTGTTACATGCAAAGGAGCCCCGTACTTTA
GTCCTAGTTTTCCATTTTGTGTATAAATGGGCTCTTTCAAGTCAATGCCCAAGCTACCAGTGGCAGTAGTTAGAGGGGGT
GAGGCAGTGATAGTAAGGGTACTGCTATCGGTGGTGGTGAGGGGGCCTGATGTTTGCAGGGCTAGCTTTCCTTCTGACAC
TGTGAGGGGTCCTTGGGTGGCAATGCTAAGTTTGGAGTCGTGCACGGTTAGCGGGGCCTGTGATTGCATGGTGAGTGTGT
TGCCCGCGACCATTAGAGGTGCGGCGGCAGCCACAGTTAGGGCTTCTGAGGTAACTGTGAGGGGTGCAGATATTTCCAGG
TTTATGTTTGACTTGGTTTTTTTGAGAGGTGGGCTCACAGTGGTTACATTTTGGGAGGTAAGGTTGCCGGCCTCGTCCAG
AGAGAGGCCGTTGCCCATTTTGAGCGCAAGCATGCCATTGGAGGTAACTAGAGGTTCGGATAGGCGCAAAGAGAGTACCC
CAGGGGGACTCTCTTGAAACCCATTGGGGGATACAAAGGGAGGAGTAAGAAAAGGCACAGTTGGAGGACCGGTTTCCGTG
TCATATGGATACACGGGGTTGAAGGTATCTTCAGACGGTCTTGCGCGCTTCATCTGCAACAACATGAAGATAGTGGGTGC
GGATGGACAGGAACAGGAGGAAACTGACATTCCATTTAGATTGTGGAGAAAGTTTGCAGCCAGGAGGAAGCTGCAATACC
AGAGCTGGGAGGAGGGCAAGGAGGTGCTGCTGAATAAACTGGACAGAAATTTGCTAACTGATTTTAAGTAAGTGATGCTT
TATTATTTTTTTTTATTAGTTAAAGGGAATAAGATCCCCGGGTACTCTAGTTAATTAACTAGAGGATCTTGATGTAATCC
AGGGTTAGGACAGTTGCAAATCACAGTGAGAACACAGGGTCCCCTGTCCCGCTCAACTAGCAGGGGGCGCTGGGTAAACT
CCCGAATCAGGCTACGGGCAAGCTCTCCCTGGGCGGTAAGCCGGACGCCGTGCGCCGGGCCCTCGATATGATCCTCGGGC
AATTCAAAGTAGCAAAACTCACCGGAGTCGCGGGCAAAGCACTTGTGGCGGCGACAGTGGACCAGGTGTTTCAGGCGCAG
TTGCTCTGCCTCTCCACTTAACATTCAGTCGTAGCCGTCCGCCGAGTCCTTTACCGCGTCAAAGTTAGGAATAAATTGAT
CCGGATAGTGGCCGGGAGGTCCCGAGAAGGGGTTAAAGTAGACCGATGGCACAAACTCCTCAATAAATTGCAGAGTTCCA
ATGCCTCCAGAGCGCGGCTCAGAGGACGAGGTCTGCAGAGTTAGGATTGCCTGACGAGGCGTGAATGAAGAGCGGCCGGC
GCCGCCGATCTGAAATGTCCCGTCCGGACGGAGACCAAGCGAGGAGCTCACCGACTCGTCGTTGAGCTGAATACCTCGCC
CTCTGATTGTCAGGTGAGTTATACCCTGCCCGGGCGACCGCACCCTGTGACGAAAGCCGCCCGCAAGCTGCGCCCCTGAG
TTAGTCATCTGAACTTCGGCCTGGGCGTCTCTGGGAAGTACCACAGTGGTGGGAGCGGGACTTTCCTGGTACACCAGGGC
AGCGGGCCAACTACGGGGATTAAGGTTATTACGAGGTGTGGTGGTAATAGCCGCCTGTTCCAGGAGAATTCGGTTTCGGT
GGGCGCGTATTCCGTTGACCCGGGATATCATGTGGGGTCCCGCGCTCATGTAGTTTATTCGGGTTGAGTAGTCTTGGGCA
GCTCCAGCCGCAAGTCCCATTTGTGGCTGGTAACTCCACATGTAGGGCGTGGGAATTTCCTTGCTCATAATGGCGCTGAC
AACAGGTGCTGGCGCCGGGTGTGGCCGCTGGAGATGACGTAGTTTTCGCGCTTAAATTTGAGAAAGGGCGCGAAACTAGT
CCTTAAGAGTCAGCGCGCAGTATTTACTGAAGAGAGCCTCCGCGTCTTCCAGCGTGCGCCGAAGCTGATCTTCGCTTTTG
TGATACAGGCAGCTGCGGGTGAGGGATCGCAGAGACCTGTTTTTTATTTTCAGCTCTTGTTCTTGGCCCCTGCTCTGTTG
AAATATAGCATACAGAGTGGGAAAAATCCTGTTTCTAAGCTCGCGGGTCGATACGGGTTCGTTGGGCGCCAGACGCAGCG
CTCCTCCTCCTGCTGCTGCCGCCGCTGTGGATTTCTTGGGCTTTGTCAGAGTCTTGCTATCCGGTCGCCTTTGCTTCTGT
GTGGCCGCTGCTGTTGCTGCCGCTGCCGCCGGTGCAGTATGGGCTGTAGAGATGACGGTAGTAATGCAGGATGTTACGGG
GGAAGGCCACGCCGTGATGGTAGAGAAGAAAGCGGCGGGCGAAGGAGATGTTGCCCCCACAGTCTTGCAAGCAAGCAACT
ATGGCGTTCTTGTGCCCGCGCCATGAGCGGTAGCCTTGGCGCTGTTGTTGCTCTTGGGCTAACGGCGGCGGCTGCTTGGA
CTTACCGGCCCTGGTTCCAGTGGTGTCCCATCTACGGTTGGGTCGGCGAACGGGCAGTGCCGGCGGCGCCTGAGGAGCGG
AGGTTGTAGCCATGCTGGAACCGGTTGCCGATTTCTGGGGCGCCGGCGAGGGGAATGCGACCGAGGGTGACGGTGTTTCG
TCTGACACCTCTTCGACCTCGGAAGCTTCCTCGTCTAGGCTCTCCCAGTCTTCCATCATGTCCTCCTCCTCCTCGTCCAA
AACCTCCTCTGCCTGACTGTCCCAGTATTCCTCCTCGTCCGTGGGTGGCGGCGGCAGCTGCAGCTTCTTTTTGGGTGCCA
TCCTGGGAAGCAAGGGCCCGCGGCTGCTGCTGATAGGGCTGCGGCGGCGGGGGGATTGGGTTGAGCTCCTCGCCGGACTG
GGGGTCCAAGTAAACCCCCCGTCCCTTTCGTAGCAGAAACTCTTGGCGGGCTTTGTTGATGGCTTGCAATTGGCCAAGAA
TGTGGCCCTGGGTAATGACGCAGGCGGTAAGCTCCGCATTAGGCGGGCGGGATTGGTCTTCGTAGAACCTAATCTCGTGG
GCGTGGTAGTCCTCAGGTACAAATTTGCGAAGGTAAGCCGACGTCCACAGCCCCGGAGTGAGTTTCAACCCCGGAGCCGC
GGACTTTTCGTCAGGCGAGGGACCCTGCAGCTCAAAGGTACCGATAATTTGACTTTCGTTAAGCAGCTGCGAATTGCAAA
CCAGGGAGCGGTGCGGGGTGCATAGGTTGCAGCGACAGTGACACTCCAGTAGACCGTCACCGCTCACGTCTTCCATTATG
TCAGAGTGGTAGGCAAGGTAGTTGGCTAGCTGCAGAAGGTAGCAGTGGCCCCAAAGCGGCGGAGGGCATTCGCGGTACTT
AATGGGCACAAAGTCGCTAGGAAGTGCACAGCAGGTGGCGGGCAAGATTCCTGAGCGCTCTAGGATAAAGTTCCTAAAGT
TCTGCAACATGCTTTGACTGGTGAAGTCTGGCAGACCCTGTTGCAGGGTTTTAAGCAGGCGTTCGGGGAAAATGATGTCC
GCCAGGTGCGCGGCCACGGAGCGCTCGTTGAAGGCCGTCCATAGGTCCTTCAAGTTTTGCTTTAGCAGTTTCTGCAGCTC
CTTGAGGTTGCACTCCTCCAAGCACTGCTGCCAAACGCCCATGGCCGTCTGCCAGGTGTAGCATAGAAATAAGTAAACGC
AGTCGCGGACGTAGTCGCGGCGCGCCTCGCCCTTGAGCGTGGAATGAAGCACGTTTTGCCCAAGGCGGTTTTCGTGCAAA
ATTCCAAGGTAGGAGACCAGGTTGCAGAGCTCCACGTTGGAGATCTTGCAGGCCTGGCGTACGTAGCCCTGTCGAAAGGT
GTAGTGCAATGTTTCCTCTAGCTTGCGCTGCATCTCCGGGTCAGCAAAGAACCGCTGCATGCACTCAAGCTCCACGGTAA
CGAGCACTGCGGCCATCATTAGTTTGCGTCGCTCCTCCAAGTCGGCAGGCTCGCGCGTTTGAAGCCAGCGCGCTAGCTGC
TCGTCGCCAACTGCGGGTAGGCCCTCCTCTGTTTGTTCTTGCAAATTTGCATCCCTCTCCAGGGGCTGCGCACGGCGCAC
GATCAGCTCACTCATGACTGTGCTCATGACCTTGGGGGGTAGGTTAAGTGCCGGGTAGGCAAAGTGGGTGACCTCGATGC
TGCGTTTTAGTACGGCTAGGCGCGCGTTGTCACCCTCGAGTTCCACCAACACTCCAGAGTGACTTTCATTTTCGCTGTTT
TCCTGTTGCAGAGCGTTTGCCGCGCGCTTCTCGTCGCGTCCAAGACCCTCAAAGATTTTTGGCACTTCGTTGAGCGAGGC
GATATCAGGTATGACAGCGCCCTGCCGCAAGGCCAGCTGCTTGTCCGCTCGGCTGCGGTTGGCACGGCAGGATAGGGGTA
TCTTGCAGTTTTGGAAAAAGATGTGATAGGTGGCAAGCACCTCTGGCACGGCAAATACGGGGTAGAAGTTGAGGCGCGGG
TTGGGCTCGCATGTGCCGTTTTCTTGGCGTTTGGGGGGTACGCGCGGTGAGAATAGGTGGCGTTCGTAGGCAAGGCTGAC
ATCCGCTATGGCGAGGGGCACATCGCTGCGCTCTTGCAACGCGTCGCAGATAATGGCGCACTGGCGCTGCAGATGCTTCA
ACAGCACGTCGTCTCCCACATCTAGGTAGTCGCCATGCCTTTCGTCCCCCCGCCCGACTTGTTCCTCGTTTGCCTCTGCG
TTGTCCTGGTCTTGCTTTTTATCCTCTGTTGGTACTGAGCGGTCCTCGTCGTCTTCGCTTACAAAACCTGGGTCCTGCTC
GATAATCACTTCCTCCTCCTCAAGCGGGGGTGCCTCGACGGGGAAGGTGGTAGGCGCGTTGGCGGCATCGGTGGAGGCGG
TGGTGGCGAACTCAGAGGGGGCGGTTAGGCTGTCCTTCTTCTCGACTGACTCCATGATCTTTTTCTGCCTATAGGAGAAG
GAAATGGCCAGTCGGGAAGAGGAGCAGCGCGAAACCACCCCCGAGCGCGGACGCGGTGCGGCGCGACGTCCCCCAACCAT
GGAGGACGTGTCGTCCCCGTCCCCGTCGCCGCCGCCTCCCCGGGCGCCCCCAAAAAAGCGGATGAGGCGGCGTATCGAGT
CCGAGGACGAGGAAGACTCATCACAAGACGCGCTGGTGCCGCGCACACCCAGCCCGCGGCCATCGACCTCGGCGGCGGAT
TTGGCCATTGCGCCCAAGAAGAAAAAGAAGCGCCCTTCTCCCAAGCCCGAGCGCCCGCCATCACCAGAGGTAATCGTGGA
CAGCGAGGAAGAAAGAGAAGATGTGGCGCTACAAATGGTGGGTTTCAGCAACCCACCGGTGCTAATCAAGCATGGCAAAG
GAGGTAAGCGCACAGTGCGGCGGCTGAATGAAGACGACCCAGTGGCGCGTGGTATGCGGACGCAAGAGGAAGAGGAAGAG
CCCAGCGAAGCGGAAAGTGAAATTACGGTGATGAACCCGCTGAGTGTGCCGATCGTGTCTGCGTGGGAGAAGGGCATGGA
GGCTGCGCGCGCGCTGATGGACAAGTACCACGTGGATAACGATCTAAAGGCGAACTTCAAACTACTGCCTGACCAAGTGG
AAGCTCTGGCGGCCGTATGCAAGACCTGGCTGAACGAGGAGCACCGCGGGTTGCAGCTGACCTTCACCAGCAACAAGACC
TTTGTGACGATGATGGGGCGATTCCTGCAGGCGTACCTGCAGTCGTTTGCAGAGGTGACCTACAAGCATCACGAGCCCAC
GGGCTGCGCGTTGTGGCTGCACCGCTGCGCTGAGATCGAAGGCGAGCTTAAGTGTCTACACGGAAGCATTATGATAAATA
AGGAGCACGTGATTGAAATGGATGTGACGAGCGAAAACGGGCAGCGCGCGCTGAAGGAGCAGTCTAGCAAGGCCAAGATC
GTGAAGAACCGGTGGGGCCGAAATGTGGTGCAGATCTCCAACACCGACGCAAGGTGCTGCGTGCACGACGCGGCCTGTCC
GGCCAATCAGTTTTCCGGCAAGTCTTGCGGCATGTTCTTCTCTGAAGGCGCAAAGGCTCAGGTGGCTTTTAAGCAGATCA
AGGCTTTTATGCAGGCGCTGTATCCTAACGCCCAGACCGGGCACGGTCACCTTTTGATGCCACTACGGTGCGAGTGCAAC
TCAAAGCCTGGGCACGCGCCCTTTTTGGGAAGGCAGCTACCAAAGTTGACTCCGTTCGCCCTGAGCAACGCGGAGGACCT
GGACGCGGATCTGATCTCCGACAAGAGCGTGCTGGCCAGCGTGCACCACCCGGCGCTGATAGTGTTCCAGTGCTGCAACC
CTGTGTATCGCAACTCGCGCGCGCAGGGCGGAGGCCCCAACTGCGACTTCAAGATATCGGCGCCCGACCTGCTAAACGCG
TTGGTGATGGTGCGCAGCCTGTGGAGTGAAAACTTCACCGAGCTGCCGCGGATGGTTGTGCCTGAGTTTAAGTGGAGCAC
TAAACACCAGTATCGCAACGTGTCCCTGCCAGTGGCGCATAGCGATGCGCGGCAGAACCCCTTTGATTTTTAAACGGCGC
AGACGGCAAGGGTGGGGGTAAATAATCACCCGAGAGTGTACAAATAAAAGCATTTGCCTTTATTGAAAGTGTCTCTAGTA
CATTATTTTTACATGTTTTTCAAGTGACAAAAAGAAGTGGCGCTCCTAATCTGCGCACTGTGGCTGCGGAAGTAGGGCGA
GTGGCGCTCCAGGAAGCTGTAGAGCTGTTCCTGGTTGCGACGCAGGGTGGGCTGTACCTGGGGACTGTTGAGCATGGAGT
TGGGTACCCCGGTAATAAGGTTCATGGTGGGGTTGTGATCCATGGGAGTTTGGGGCCAGTTGGCAAAGGCGTGGAGAAAC
ATGCAGCAGAATAGTCCACAGGCGGCCGAGTTGGGCCCCTGTACGCTTTGGGTGGACTTTTCCAGCGTTATACAGCGGTC
GGGGGAAGAAGCAATGGCGCTACGGCGCAGGAGTGACTCGTACTCAAACTGGTAAACCTGCTTGAGTCGCTGGTCAGAAA
AGCCAAAGGGCTCAAAGAGGTAGCATGTTTTTGAGTGCGGGTTCCAGGCAAAGGCCATCCAGTGTACGCCCCCAGTCTCG
GTCCGAGACTCGAACCGGGGGTCCCGCGACTCAACCCTTGGAAAATAACCCTCCGGCTACAGGGAGCGAGCCACTTAATG
CTTTCGCTTTCCAGCCTAACCGCTTACGCTGCGCGCGGCCAGTGGCCAAAAAAGCTAGCGCAGCAGCCGCCGCGCCTGGA
AGGAAGCCAAAAGGAGCACTCCCCCGTTGTCTGACGTCGCACACCTGGGTTCGACACGCGGGCGGTAACCGCATGGATCA
CGGCGGACGGCCGGATACGGGGCTCGAACCCCGGTCGTCCGCCATGATACCCTTGCGAATTTATCCACCAGACCACGGAA
GAGTGCCCGCTTACAGGCTCTCCTTTTGCACGCTAGAGCGTCAACGATTGCGCGCGCCTGACCGGCCAGAGCGTCCCGAC
CATGGAGCACTTTTTGCCGCTGCGCAACATCTGGAACCGCGTCCGCGACTTTCCGCGCGCCTCCACCACCGCCGCCGGCA
TCACCTGGATGTCCAGGTACATCTACGGATATCATCGCCTTATGTTGGAAGATCTCGCCCCCGGAGCCCCGGCCACCCTA
CGCTGGCCCCTCTACCGCCAGCCGCCGCCGCACTTTTTGGTGGGATACCAGTACCTGGTGCGGACTTGCAACGACTACGT
ATTTGACTCGAGGGCTTACTCGCGTCTCAGGTACACCGAGCTCTCGCAGCCGGGTCACCAGACCGTTAACTGGTCCGTTA
TGGCCAACTGCACTTACACCATCAACACGGGCGCATACCACCGCTTTGTGGACATGGATGACTTCCAGTCTACCCTCACG
CAGGTGCAGCAGGCCATATTAGCCGAGCGCGTTGTCGCCGACCTAGCCCTGCTTCAGCCGATGAGGGGCTTCGGGGTCAC
ACGCATGGGAGGAAGAGGGCGCCACCTACGGCCAAACTCCGCCGCCGCCGCAGCGATAGATGCAAGAGATGCAGGACAAG
AGGAAGGAGAAGAAGAAGTGCCGGTAGAAAGGCTCATGCAAGACTACTACAAAGACCTGCGCCGATGTCAAAACGAAGCC
TGGGGCATGGCCGACCGCCTGCGCATTCAGCAGGCCGGACCCAAGGACATGGTGCTTCTG
//

*For Lab research use only

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart