

  • Model: PVT5010
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT5010      2ug


pAX01 Information

Promoter: xylA promoter

Replicon: ColE1 ori

Terminator: T1 terminator, T2 Terminator

Plasmid classification: hay series plasmid, hay integration plasmid, plasmid in hay.

Plasmid size: 7781bp

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Screening markers: erythromycin ERM

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic LB

Expression host: Bacillus subtilis, BS168 and other Bacillus subtilis

Inducement: xylose induction

5'sequencing primers: pAX-F (GTTGCCCTGGAGACAGGGG)

3'sequencing primers: pAX-R (GATATGGTGCAAGTCAGCACG)

Use: Bacillus subtilis


pAX01 Description

pAX01 plasmid has no pathogenicity, safety and no obvious codon bias. Adding signal peptide can directly secrete the expressed protein into the medium (at present, about 60% of the commercially available enzymes are produced by Bacillus subtilis), the expression product is soluble, the expression product is separated from the intracellular protein, and it does not need to break the cells, which is beneficial to the separation and purification, and is beneficial to the separation and purification. The mechanism of Bacillus subtilis transcription, translation, protein folding and secretion is clear, which is conducive to genetic manipulation and large-scale fermentation. Based on Escherichia coli bacillus subtilis shuttle plasmid expression vector pAX01, high expression of recombinant foreign protein in Bacillus subtilis can be achieved. The full length of the pAX01 plasmid is 7781bp, and the carrier is based on the groE operon of the Bacillus subtilis based on strong Sigma A- dependent promoter, and is transformed into a highly efficient and controllable promoter by adding operon.

pAX01 expression vector is a Bacillus subtilis, replicon plasmid ori, size 7781bp, e. (Amp); Bacillus subtilis (erythromycin resistance), can be transformed into Escherichia coli DH5 alpha, the coliform (Amp); Bacillus subtilis (erythromycin resistance) plate culture screening a large number of replication amplification culture conditions is LB, 37 C.




pAX01 Sequence

LOCUS       Exported File           7781 bp ds-DNA    circular SYN 18-4-2015
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7781)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-4-18 
FEATURES             Location/Qualifiers
     source          1..7781
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     terminator      660..687
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB 
     terminator      706..792
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB 
     promoter        2078..2182
                     /note="AmpR promoter"
     promoter        4352..4456
                     /note="AmpR promoter"
     CDS             4457..5317
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      5488..6076
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     misc_feature    6262..6402
                     /note="basis of mobility region from pBR322"
     CDS             complement(6504..6695)
                     /product="Rop protein, which maintains plasmids at low copy
        1 ggggtgatgt caaagcttga aaaaacgcac gtaacaaaag caaaatttat gctccatggg
       61 ggagactaca accccgatca gtggctggat cggcccgata ttttagctga cgatatcaaa
      121 ctgatgaagc tttctcatac gaatacgttt tctgtcggca tttttgcatg gagcgcactt
      181 gagccggagg agggcgtata tcaatttgaa tggctggatg atatttttga gcggattcac
      241 agtataggcg gccgggtcat attagcaacg ccgagcggag cccgtccggc ctggctgtcg
      301 caaacctatc cggaagtttt gcgcgtcaat gcctcccgcg tcaaacagct gcacggcgga
      361 aggcacaacc actgcctcac atctaaagtc taccgagaaa aaacacggca catcaaccgc
      421 ttattagcag aacgatacgg acatcacccg gcgctgttaa tgtggcacat ttcaaacgaa
      481 tacgggggag attgccactg tgaatcgatg cggccgctct agagcaacgt tcttgccatt
      541 gctgcataaa aaacgcccgg cggcaaccga gcgttctgaa ttaattaatc atcgggaaga
      601 tcttcatcac cgaaacgcgg caggcagctc tagagttaac aagagtttgt agaaacgcaa
      661 aaaggccatc cgtcaggatg gccttctgct tagctagagc ggcggatttg tcctactcag
      721 gagagcgttc accgacaaac aacagataaa acgaaaggcc cagtctttcg actgagcctt
      781 tcgttttatt tgatgcctca agctagagag tcattaccag atctcactgc agagatcccc
      841 gggtctagag tctagggacc tctttagctc cttggaagct gtcagtagta tacctaataa
      901 tttatctaca ttccctttag taacgtgtaa ctttccaaat ttacaaaagc gactcataga
      961 attatttcct cccgttaaat aatagataac tattaaaaat agacaatact tgctcataag
     1021 taacggtact taaattgttt actttggcgt gtttcattgc ttgatgaaac tgatttttag
     1081 taaacagttg acgatattct cgattgaccc attttgaaac aaagtacgta tatagcttcc
     1141 aatatttatc tggaacatct gtggtatggc gggtaagttt tattaagaca ctgtttactt
     1201 ttggtttagg atgaaagcat tccgctggca gcttaagcaa ttgctgaatc gagacttgag
     1261 tgtgcaagag caaccctagt gttcggtgaa tatccaaggt acgcttgtag aatccttctt
     1321 caacaatcag atagatgtca gacgcatggc tttcaaaaac cactttttta ataatttgtg
     1381 tgcttaaatg gtaaggaata ctcccaacaa ttttatacct ctgtttgtta gggaattgaa
     1441 actgtagaat atcttggtga attaaagtga cacgagtatt cagttttaat ttttctgacg
     1501 ataagttgaa tagatgactg tctaattcaa tagacgttac ctgtttactt attttagcca
     1561 gtttcgtcgt taaatgccct ttacctgttc caatttcgta aacggtatcg gtttctttta
     1621 aattcaattg ttttattatt tggttgagta ctttttcact cgttaaaaag ttttgagaat
     1681 attttatatt tttgttcatg taatcactcc ttcttaatta caaattttta gcatctaatt
     1741 taacttcaat tcctattata caaaatttta agatactgca ctatcaacac actcttaagt
     1801 ttgcttctaa gtcttatttc cataacttct tttacgtttc cgccattctt tgctgtttcg
     1861 atttttatga tatggtgcaa gtcagcacga acacgaaccg tcttatctcc cattatatct
     1921 ttttttgcac tgattggtgt atcatttcgt ttttcttttg tgctagagga tcaattcttg
     1981 aagacgaaag ggcctcgtga tacgcctatt tttataggtt aatgtcatga taataatggt
     2041 ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt
     2101 tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca
     2161 ataatattga aaaaggaaga gtgcggccgc ccgcgggagc tcggatccca tttccccctt
     2221 tgatttttag atatcactag tttggaccat ttgtcatttc cccctttgat ttaagtgaac
     2281 aagtttatcc atcaactatc ttaattgagt tagtttgttt atccaataaa ctaactttat
     2341 ctcatcatat acaaaataaa tgtttatttc aatgtttttt ttagaaaatt tagttataat
     2401 attagatatg atacttttaa atatctaatt caagcttcaa aaaacaccaa cttagttcgg
     2461 tggataaaca aaggagtggt tattattcaa attgcagatc aagctttagt aaaaaaaatg
     2521 aatcaaaaat taatattaga tgaaattttg aagaactccc ctgtctccag ggcaactctc
     2581 tctgagatta caggattaaa caagtctact gtctcctctc aagtaaatac actgcttgaa
     2641 aaagatttta tttttgaaat tggggcaggg caatctagag gcggcagaag acctgtaatg
     2701 cttgttttta ataagaatgc aggctactcg attggtattg atataggagt cgactatctt
     2761 aacggaattc taaccgactt agaaggaaat attattctcg agaagacttc tgacttgtct
     2821 agttcttccg ctagtgaagt aaaagagatt ttatttgcac ttattcatgg ttttgtaacc
     2881 catatgcctg agtcccctta tggtctagtc ggaataggaa tttgtgttcc aggccttgta
     2941 gatcgtcatc agcaaattat tttcatgcct aacttaaatt ggaatatcaa agatttgcag
     3001 tttttaattg agagtgagtt taatgttccg gtttttgttg aaaatgaagc taatgcagga
     3061 gcatacggtg aaaaagtatt tggtatgaca aaaaactatg aaaacatcgt ttacatcagt
     3121 attaatatcg gaattggaac tggacttgtt attaacaacg aattgtataa aggtgttcag
     3181 ggtttttctg gggaaatggg tcatatgacg atagatttta atggacccaa atgcagctgt
     3241 ggaaatcgag gctgttggga attatatgct tctgaaaaag cgttactggc ttcgctctct
     3301 aaagaagaaa agaatatttc tcgaaaagag attgtggaac gcgcaaataa aaatgatgta
     3361 gaaatgttaa atgcacttca aaactttggc ttttatatcg gaattggatt aaccaatatc
     3421 cttaatacat ttgatataga agctgttatc ttgagaaatc atataattga atctcatccc
     3481 attgttttaa atacgattaa aaacgaagtt tcttctagag tccattctca tttagacaat
     3541 aaatgtgaac tattgccttc ttcgttagga aaaaatgcac ctgctttagg agcggtttct
     3601 atcgttattg attctttttt aagtgttacc cctataagtt aggagctccc cgggacgttc
     3661 ttgccattgc tgcataaaaa acgcccggcg gcaaccgagc gttctgaatt aattaatcat
     3721 cgcgactgca gagatatcga tttcaagcta tatttggagt tgagcctctt gaaacggaca
     3781 ccctgtatcc gaaggatcga aacgctgtca gctaccgcag ccaaatatat gaaatgaagg
     3841 attatgcaac cgtgattgat gtaaagacag cttcagtgga agcggtgtat caagaagatt
     3901 tttatgcgcg cacgccagcg gtcacaagcc atgagtatca gcagggcaag gcgtatttta
     3961 tcggcgcgcg tttggaggat caatttcagc gtgatttcta tgagggtctg atcacagacc
     4021 tgtctctctc tccagttttt ccggttcggc acggaaaagg cgtctccgta caagcgaggc
     4081 aggatcagga caatgattat atttttgtca tgaatttcac ggaagaaaaa cagctggtca
     4141 cgtttgatca gagtgtgaag gacataatga caggagacat attgtcaggc gacctgacga
     4201 tggaaaagta tgaagtgaga attgtcgtaa acacacatta gcccatcatt cttgaagacg
     4261 aaagggcctc gtgatacgcc tatttttata ggttaatgtc atgataataa tggtttctta
     4321 gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta
     4381 aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata
     4441 ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc
     4501 ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga
     4561 agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct
     4621 tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg
     4681 tggcgcggta ttatcccgtg ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta
     4741 ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat
     4801 gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt
     4861 acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga
     4921 tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga
     4981 gcgtgacacc acgatgcctg cagcaatggc aacaacgttg cgcaaactat taactggcga
     5041 actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc
     5101 aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc
     5161 cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg
     5221 tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat
     5281 cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata
     5341 tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct
     5401 ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga
     5461 ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg
     5521 cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc
     5581 aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct
     5641 agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc
     5701 tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt
     5761 ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg
     5821 cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagca
     5881 ttgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag
     5941 ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag
     6001 tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg
     6061 gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg
     6121 gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac
     6181 cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt
     6241 gagcgaggaa gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat
     6301 ttcacaccgc atatggtgca ctctcagtac aatctgctct gatgccgcat agttaagcca
     6361 gtatacactc cgctatcgct acgtgactgg gtcatggctg cgccccgaca cccgccaaca
     6421 cccgctgacg cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg
     6481 accgtctccg ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgagg
     6541 cagctgcggt aaagctcatc agcgtggtcg tgaagcgatt cacagatgtc tgcctgttca
     6601 tccgcgtcca gctcgttgag tttctccaga agcgttaatg tctggcttct gataaagcgg
     6661 gccatgttaa gggcggtttt ttcctgtttg gtcacttgat gcctccgtgt aagggggaat
     6721 ttctgttcat gggggtaatg ataccgatga aacgagagag gatgctcacg atacgggtta
     6781 ctgatgatga acatgcccgg ttactggaac gttgtgaggg taaacaactg gcggtatgga
     6841 tgcggcggga ccagagaaaa atcactcagg gtcaatgcca gcgcttcgtt aatacagatg
     6901 taggtgttcc acagggtagc cagcagcatc ctgcgatgca gatccggaac ataatggtgc
     6961 agggcgctga cttccgcgtt tccagacttt acgaaacacg gaaaccgaag accattcatg
     7021 ttgttgctca ggtcgcagac gttttgcagc agcagtcgct tcacgttcgc tcgcgtatcg
     7081 gtgattcatt ctgctaacca gtaaggcaac cccgccagcc tagccgggtc ctcaacgaca
     7141 ggagcacgat catgcgcacc cgtggccagg acccaacgct gcccgagatg cgccgcgtgc
     7201 ggctgctgga gatggcggac gcgatggata tgttctgcca agggttggtt tgcgcattca
     7261 cagttctccg caagaattga ttggctccaa ttcttggagt ggtgaatccg ttagcgaggt
     7321 gccgccggct tccattcagg tcgaggtggc ccggctccat gcaccgcgac gcaacgcggg
     7381 gaggcagaca aggtataggg cggcgcctac aatccatgcc aacccgttcc atgtgctcgc
     7441 cgaggcggca taaatcgccg tgacgatcag cggtccagtg atcgaagtta ggctggtaag
     7501 agccgcgagc gatccttgaa gctgtccctg atggtcgtca tctacctgcc tggacagcat
     7561 ggcctgcaac gcgggcatcc cgatgccgcc ggaagcgaga agaatcataa tggggaaggc
     7621 catccagcct cgcgtcgcga ctaagaaaat gccgtcaaat ccgctcgcca tgacttcact
     7681 aacgatgcct ttgaaaatct tcaagttctt ttctactaat tcaaggcgtg tctcaccagg
     7741 tttttggttt gctccggcgc aaatgcagac aatatcagga t


Product is for research use only!


Search name

pAX01,Plasmid pAX01,pAX01 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
