pBAD/ gIII C Plasmid


  • Model: PVT0715
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pBAD/gIII C,Plasmid pBAD/gIII C,pBAD/gIII C vector


pBAD/gIII C Information

Promoter: araBad
Replicon: PBR322 ori
Plasmid classification: Escherichia coli vector; pBAD series expression plasmid
Plasmid size: 4149bp
Plasmid label: N-GIII signal, C-His, C-Myc
Prokaryotic resistance: ampicillin Amp
Cloned strain: Top10
Culture conditions: 37 centigrade, aerobic, LB
Expressing the host: recommending LMG194
Culture conditions: 37 centigrade, aerobic, LB
Inducement: Arabia sugar
5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC
3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG


pBAD/gIII C Description

pBAD/gIII carrier is derived from pBR322 vector. The carrier is designed to regulate secretory expression and purify the recombinant protein in Escherichia coli. The recombinant protein was located using the gene III signal sequence to make it secreted into the periplasmic cavity of Escherichia coli. The use of Escherichia coli araBAD promoter (pBAD) enhanced the level of soluble expression of recombinant protein of Escherichia coli. The regulatory protein AraC on the carrier can regulate the pBad promoter.



pBAD/gIII C Sequence

LOCUS       Exported                4149 bp ds-DNA    circular SYN 19-9-2015
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4149)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-9-19    
FEATURES             Location/Qualifiers
     source          1..4149
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        120..285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
     CDS             431..460
                     /product="Myc (human c-Myc oncogene) epitope tag"
     CDS             476..493
                     /product="6xHis affinity tag"
     terminator      719..805
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      897..924
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        944..1035
                     /note="AmpR promoter"
     CDS             1036..1896
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2067..2655
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2841..2981
                     /note="basis of mobility region from pBR322"
     CDS             complement(3245..4123)
                     /product="L-arabinose regulatory protein"
        1 aagaaaccaa ttgtccatat tgcatcagac attgccgtca ctgcgtcttt tactggctct
       61 tctcgctaac caaaccggta accccgctta ttaaaagcat tctgtaacaa agcgggacca
      121 aagccatgac aaaaacgcgt aacaaaagtg tctataatca cggcagaaaa gtccacattg
      181 attatttgca cggcgtcaca ctttgctatg ccatagcatt tttatccata agattagcgg
      241 atcctacctg acgcttttta tcgcaactct ctactgtttc tccatacccg ttttttgggc
      301 taacaggagg aattaaccat gaaaaaactg ctgttcgcga ttccgctggt ggtgccgttc
      361 tatagccata gcaccatggc ggccgctcga gatctgcagc tggtaccata tgggaattcg
      421 aagctttcta gaacaaaaac tcatctcaga agaggatctg aatagcgccg tcgaccatca
      481 tcatcatcat cattgagttt aaacggtctc cagcttggct gttttggcgg atgagagaag
      541 attttcagcc tgatacagat taaatcagaa cgcagaagcg gtctgataaa acagaatttg
      601 cctggcggca gtagcgcggt ggtcccacct gaccccatgc cgaactcaga agtgaaacgc
      661 cgtagcgccg atggtagtgt ggggtctccc catgcgagag tagggaactg ccaggcatca
      721 aataaaacga aaggctcagt cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt
      781 gaacgctctc ctgagtagga caaatccgcc gggagcggat ttgaacgttg cgaagcaacg
      841 gcccggaggg tggcgggcag gacgcccgcc ataaactgcc aggcatcaaa ttaagcagaa
      901 ggccatcctg acggatggcc tttttgcgtt tctacaaact ctttttgttt atttttctaa
      961 atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat
     1021 tgaaaaagga agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg
     1081 gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa
     1141 gatcagttgg gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt
     1201 gagagttttc gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt
     1261 ggcgcggtat tatcccgtgt tgacgccggg caagagcaac tcggtcgccg catacactat
     1321 tctcagaatg acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg
     1381 acagtaagag aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta
     1441 cttctgacaa cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat
     1501 catgtaactc gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag
     1561 cgtgacacca cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa
     1621 ctacttactc tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca
     1681 ggaccacttc tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc
     1741 ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt
     1801 atcgtagtta tctacacgac ggggagtcag gcaactat

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
