
  • Model: PVT10610
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10610
Packing 2ug


pBAD-gIIIA Information
Function E.coli expression plasmid
Resistance Amp
Screen /
Strain DH5alpha
Culture temperature 37degrees centigrade
Replicon pBR322
Copy Low
Promoter araBAD
Induction Arabia sugar
Forward primer pBAD-F
Reverse primer pBAD-R


pBAD-gIIIA Information

Alias: pBAD-gIIIA

Promoter: araBad

Replicon: PBR322 ori

Plasmid classification: Escherichia coli vector; pBAD series expression plasmid

Plasmid size: 4145bp

Plasmid label: N-GIII signal, C-His, C-Myc

Prokaryotic resistance: ampicillin Amp

Cloned strain: Top10

Culture conditions: 37 centigrade, aerobic, LB

Expressing the host: recommending LMG194

Culture conditions: 37 centigrade, aerobic, LB

Inducement: Arabia sugar

5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC

3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG


pBAD-gIIIA Description



pBAD-gIIIA Sequence

LOCUS       Exported                4145 bp ds-DNA     circular SYN 12-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4145)
  TITLE     Direct Submission
  JOURNAL   Exported Monday, September 12, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4145
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        1..285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
                     direction (Guzman et al., 1995)"
     CDS             427..456
                     /product="Myc (human c-Myc oncogene) epitope tag"
     CDS             472..489
                     /product="6xHis affinity tag"
     terminator      715..801
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      893..920
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        940..1031
                     /note="AmpR promoter"
     CDS             1032..1892
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2063..2651
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2837..2977
                     /note="basis of mobility region from pBR322"
     CDS             complement(3241..4119)
                     /product="L-arabinose regulatory protein"
        1 aagaaaccaa ttgtccatat tgcatcagac attgccgtca ctgcgtcttt tactggctct
       61 tctcgctaac caaaccggta accccgctta ttaaaagcat tctgtaacaa agcgggacca
      121 aagccatgac aaaaacgcgt aacaaaagtg tctataatca cggcagaaaa gtccacattg
      181 attatttgca cggcgtcaca ctttgctatg ccatagcatt tttatccata agattagcgg
      241 atcctacctg acgcttttta tcgcaactct ctactgtttc tccatacccg ttttttgggc
      301 taacaggagg aattaaccat gaaaaaactg ctgttcgcga ttccgctggt ggtgccgttc
      361 tatagccata gcaccatgga gctcgagatc tgcagctggt accatatggg aattcgaagc
      421 tttctagaac aaaaactcat ctcagaagag gatctgaata gcgccgtcga ccatcatcat
      481 catcatcatt gagtttaaac ggtctccagc ttggctgttt tggcggatga gagaagattt
      541 tcagcctgat acagattaaa tcagaacgca gaagcggtct gataaaacag aatttgcctg
      601 gcggcagtag cgcggtggtc ccacctgacc ccatgccgaa ctcagaagtg aaacgccgta
      661 gcgccgatgg tagtgtgggg tctccccatg cgagagtagg gaactgccag gcatcaaata
      721 aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta tctgttgttt gtcggtgaac
      781 gctctcctga gtaggacaaa tccgccggga gcggatttga acgttgcgaa gcaacggccc
      841 ggagggtggc gggcaggacg cccgccataa actgccaggc atcaaattaa gcagaaggcc
      901 atcctgacgg atggcctttt tgcgtttcta caaactcttt ttgtttattt ttctaaatac
      961 attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa
     1021 aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat
     1081 tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
     1141 agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga
     1201 gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg
     1261 cggtattatc ccgtgttgac gccgggcaag agcaactcgg tcgccgcata cactattctc
     1321 agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag
     1381 taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc
     1441 tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg
     1501 taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg
     1561 acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac
     1621 ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac
     1681 cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg
     1741 agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg
     1801 tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg
     1861 agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac
     1921 tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg
     1981 ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg
     2041 tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc
     2101 aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc
     2161 tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt
     2221 agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc
     2281 taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact
     2341 caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac
     2401 agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag
     2461 aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg
     2521 gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg
     2581 tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
     2641 gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt
     2701 ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct
     2761 ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg
     2821 aggaagcgga agagcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac
     2881 accgcatatg gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagtata
     2941 cactccgcta tcgctacgtg actgggtcat ggctgcgccc cgacacccgc caacacccgc
     3001 tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt
     3061 ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgaggcagca
     3121 gatcaattcg cgcgcgaagg cgaagcggca tgcataatgt gcctgtcaaa tggacgaagc
     3181 agggattctg caaaccctat gctactccgt caagccgtca attgtctgat tcgttaccaa
     3241 ttatgacaac ttgacggcta catcattcac tttttcttca caaccggcac ggaactcgct
     3301 cgggctggcc ccggtgcatt ttttaaatac ccgcgagaaa tagagttgat cgtcaaaacc
     3361 aacattgcga ccgacggtgg cgataggcat ccgggtggtg ctcaaaagca gcttcgcctg
     3421 gctgatacgt tggtcctcgc gccagcttaa gacgctaatc cctaactgct ggcggaaaag
     3481 atgtgacaga cgcgacggcg acaagcaaac atgctgtgcg acgctggcga tatcaaaatt
     3541 gctgtctgcc aggtgatcgc tgatgtactg acaagcctcg cgtacccgat tatccatcgg
     3601 tggatggagc gactcgttaa tcgcttccat gcgccgcagt aacaattgct caagcagatt
     3661 tatcgccagc agctccgaat agcgcccttc cccttgcccg gcgttaatga tttgcccaaa
     3721 caggtcgctg aaatgcggct ggtgcgcttc atccgggcga aagaaccccg tattggcaaa
     3781 tattgacggc cagttaagcc attcatgcca gtaggcgcgc ggacgaaagt aaacccactg
     3841 gtgataccat tcgcgagcct ccggatgacg accgtagtga tgaatctctc ctggcgggaa
     3901 cagcaaaata tcacccggtc ggcaaacaaa ttctcgtccc tgatttttca ccaccccctg
     3961 accgcgaatg gtgagattga gaatataacc tttcattccc agcggtcggt cgataaaaaa
     4021 atcgagataa ccgttggcct caatcggcgt taaacccgcc accagatggg cattaaacga
     4081 gtatcccggc agcaggggat cattttgcgc ttcagccata cttttcatac tcccgccatt
     4141 cagag

Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
