pBAD- HisA


  • Model: PVT10606
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10606
Packing 2ug


pBAD-HisA Information
Function E.coli expression plasmid

Promoter: araBAD promoter

Replicon: pBR322 ori

Terminator: rrnB T1 Terminator

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pBAD series plasmid.

Plasmid size: 4102bp

Plasmid label: N-His, N-EK, N-xPress Epitope

Prokaryotic resistance: ampicillin Amp

Cloned strains of Escherichia coli, Top10 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression of host: LMG194 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: Arabia sugar

5'sequencing primers: PBAD30.F (AGATTAGCGGATCCTACCTG)

3'sequencing primers: PBAD30.R (CACTTCTGAGTTCGGCATGG)



pBAD-HisA Description

PBAD-HisA plasmids are derived from pBR322 vectors. The vector is designed to express and purify recombinant target protein in Escherichia coli in a dose-dependent manner. The E.coli araBAD promoter (pBAD) enhanced the soluble expression level of E.coli recombinant protein. The regulatory protein AraC on pBAD/His and pBAD/Myc His vectors can regulate pBad promoter. The pBAD/Myc-His A carrier is the Arabia sugar control carrier; in the glucose free medium, the Arabia sugar is positively regulating the expression of the target gene, and the soluble expression of the target protein is optimized by regulating the concentration level of the sugar in Arabia.



pBAD-HisA Sequence

LOCUS       Exported                4102 bp ds-DNA    circular SYN 14-9-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4102)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-9-14  
FEATURES             Location/Qualifiers
     source          1..4102
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        120..285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
     CDS             331..348
                     /product="6xHis affinity tag"
     CDS             352..384
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
     CDS             388..411
                     /product="Xpress(TM) epitope tag, including an enterokinase
                     recognition and cleavage site"
                     /note="Xpress(TM) tag"
     terminator      673..759
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      851..878
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        897..988
                     /note="AmpR promoter"
     CDS             989..1849
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2020..2608
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2794..2934
                     /note="basis of mobility region from pBR322"
     CDS             complement(3198..4076)
                     /product="L-arabinose regulatory protein"
        1 aagaaaccaa ttgtccatat tgcatcagac attgccgtca ctgcgtcttt tactggctct
       61 tctcgctaac caaaccggta accccgctta ttaaaagcat tctgtaacaa agcgggacca
      121 aagccatgac aaaaacgcgt aacaaaagtg tctataatca cggcagaaaa gtccacattg
      181 attatttgca cggcgtcaca ctttgctatg ccatagcatt tttatccata agattagcgg
      241 atcctacctg acgcttttta tcgcaactct ctactgtttc tccatacccg ttttttgggc
      301 taacaggagg aattaaccat ggggggttct catcatcatc atcatcatgg tatggctagc
      361 atgactggtg gacagcaaat gggtcgggat ctgtacgacg atgacgataa ggatcgatgg
      421 ggatccgagc tcgagatctg cagctggtac catatgggaa ttcgaagctt ggctgttttg
      481 gcggatgaga gaagattttc agcctgatac agattaaatc agaacgcaga agcggtctga
      541 taaaacagaa tttgcctggc ggcagtagcg cggtggtccc acctgacccc atgccgaact
      601 cagaagtgaa acgccgtagc gccgatggta gtgtggggtc tccccatgcg agagtaggga
      661 actgccaggc atcaaataaa acgaaaggct cagtcgaaag actgggcctt tcgttttatc
      721 tgttgtttgt cggtgaacgc tctcctgagt aggacaaatc cgccgggagc ggatttgaac
      781 gttgcgaagc aacggcccgg agggtggcgg gcaggacgcc cgccataaac tgccaggcat
      841 caaattaagc agaaggccat cctgacggat ggcctttttg cgtttctaca aactcttttg
      901 tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat
      961 gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat
     1021 tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt
     1081 aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag
     1141 cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa
     1201 agttctgcta tgtggcgcgg tattatcccg tgttgacgcc gggcaagagc aactcggtcg
     1261 ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct
     1321 tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
