

  • Model: PVT0708
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0708        2ug


pBAD18 Information

Promoter: araBad
Replicon: PBR322 ori
Plasmid classification: Escherichia coli vector; pBAD series expression plasmid
Plasmid size: 4613bp
Prokaryotic resistance: ampicillin Amp
Cloned strain: Top10
Culture conditions: 37 centigrade, aerobic, LB
Expressing the host: recommending LMG194
Culture conditions: 37 centigrade, aerobic, LB
Inducement: Arabia sugar
5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC
3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG


pBAD18 Description

pBAD18 is one of several tightly controlled expression vectors regulated by the arabinose operon. Vectors differ in replicon, antibiotic resistance marker, multiple cloning site and need for translation initiation sequences. Cultures should be grown in minimal media for more reproducible induction of expression. Expression is induced in glycerolcontaining media by the addition of arabinose. Expression is repressed by addition of glucose or other catabolites. Cloned inserts must provide a translation initiation sequence (ATG) and ribosome binding site for expression. Expression of cloned inserts in the two recommended hosts differ in terms of induction characteristics, especially when using low concentrations of inducer (arabinose) and growing in minimal media. The following primers can be used for sequencing of cloned inserts: 5 primer (278bp upstream of the NheI site) :5 CTGTTTCTCCATACCCGTT 3and one of two 3 primers:3 primer 1 (219bp downstream of the HindIII site):5 CTCATCCGCCAAAACAG 33 primer 2 (1733bp downstream of the HindIII site):5 GGCTGAAAATCTTCTCT3




pBAD18 Sequence


LOCUS       Exported                4613 bp ds-DNA     circular SYN 11-SEP-2016

DEFINITION  synthetic circular DNA




SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4613)


  TITLE     Direct Submission

  JOURNAL   Exported Sep 26, 2017

FEATURES             Location/Qualifiers

     source          1..4613

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             complement(96..974)



                     /product="L-arabinose regulatory protein"








     promoter        1001..1285


                     /label=araBAD promoter

                     /note="promoter of the L-arabinose operon of E. coli; the 

                     araC regulatory gene is transcribed in the opposite 

                     direction (Guzman et al., 1995)"

     misc_feature    1306..1362


                     /note="pUC18/19 multiple cloning site"

     terminator      1565..1651

                     /gene="Escherichia coli rrnB"

                     /label=rrnB T1 terminator

                     /note="transcription terminator T1 from the E. coli rrnB 


     terminator      1743..1770

                     /label=rrnB T2 terminator

                     /note="transcription terminator T2 from the E. coli rrnB 


     promoter        1789..1880


                     /label=AmpR promoter

     CDS             1881..2741





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      2783..3238


                     /label=f1 ori

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     rep_origin      3349..3937



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     misc_feature    4123..4263


                     /note="basis of mobility region from pBR322"


        1 atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac

       61 tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca

      121 ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta

      181 aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata

      241 ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag

      301 cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag

      361 caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg

      421 tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct

      481 tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc

      541 ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc

      601 gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca

      661 tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga

      721 tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa

      781 acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata

      841 taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc

      901 ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt

      961 tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat

     1021 tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta

     1081 accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt

     1141 aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca

     1201 ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta

     1261 tcgcaactct ctactgtttc tccatacccg tttttttggg ctagcgaatt cgagctcggt

     1321 acccggggat cctctagagt cgacctgcag gcatgcaagc ttggctgttt tggcggatga

     1381 gagaagattt tcagcctgat acagattaaa tcagaacgca gaagcggtct gataaaacag

     1441 aatttgcctg gcggcagtag cgcggtggtc ccacctgacc ccatgccgaa ctcagaagtg

     1501 aaacgccgta gcgccgatgg tagtgtgggg tctccccatg cgagagtagg gaactgccag

     1561 gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta tctgttgttt

     1621 gtcggtgaac gctctcctga gtaggacaaa tccgccggga gcggatttga acgttgcgaa

     1681 gcaacggccc ggagggtggc gggcaggacg cccgccataa actgccaggc atcaaattaa

     1741 gcagaaggcc atcctgacgg atggcctttt tgcgtttcta caaactcttt tgtttatttt

     1801 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat

     1861 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt

     1921 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg

     1981 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga

     2041 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc

     2101 tatgtggcgc ggtattatcc cgtgttgacg ccgggcaaga gcaactcggt cgccgcatac

     2161 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg

     2221 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca

     2281 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg

     2341 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg

     2401 acgagcgtga caccacgatg cctgcagcaa tggcaacaac gttgcgcaaa ctattaactg

     2461 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag

     2521 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg

     2581 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct

     2641 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac

     2701 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact

     2761 catatatact ttagattgat ttacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg

     2821 gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc tcctttcgct

     2881 ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct aaatcggggg

     2941 ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa acttgatttg

     3001 ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc tttgacgttg

     3061 gagtccacgt tctttaatag tggactcttg ttccaaactt gaacaacact caaccctatc

     3121 tcgggctatt cttttgattt ataagggatt ttgccgattt cggcctattg gttaaaaaat

     3181 gagctgattt aacaaaaatt taacgcgaat tttaacaaaa tattaacgtt tacaatttaa

     3241 aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt

     3301 ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt

     3361 ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg

     3421 tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca

     3481 gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt

     3541 agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga

     3601 taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc

     3661 gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact

     3721 gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga

     3781 caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg

     3841 aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt

     3901 tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt

     3961 acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga

     4021 ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac

     4081 gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcctgatgc ggtattttct

     4141 ccttacgcat ctgtgcggta tttcacaccg catatggtgc actctcagta caatctgctc

     4201 tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg ggtcatggct

     4261 gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca

     4321 tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg

     4381 tcatcaccga aacgcgcgag gcagcaagga gatggcgccc aacagtcccc cggccacggg

     4441 gcctgccacc atacccacgc cgaaacaagc gctcatgagc ccgaagtggc gagcccgatc

     4501 ttccccatcg gtgatgtcgg cgatataggc gccagcaacc gcacctgtgg cgccggtgat

     4561 gccggccacg atgcgtccgg cgtagaggat ctgctcatgt ttgacagctt atc


Product is for research use only!


Search name

pBAD18,Plasmid pBAD18,pBAD18 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
