pBAD18 Plasmid


  • Model: PVT0708
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pBAD18,Plasmid pBAD18,pBAD18 vector


pBAD18 Information

Promoter: araBad
Replicon: PBR322 ori
Plasmid classification: Escherichia coli vector; pBAD series expression plasmid
Plasmid size: 4613bp
Prokaryotic resistance: ampicillin Amp
Cloned strain: Top10
Culture conditions: 37 centigrade, aerobic, LB
Expressing the host: recommending LMG194
Culture conditions: 37 centigrade, aerobic, LB
Inducement: Arabia sugar
5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC
3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG


pBAD18 Description

pBAD18 is one of several tightly controlled expression vectors regulated by the arabinose operon. Vectors differ in replicon, antibiotic resistance marker, multiple cloning site and need for translation initiation sequences. Cultures should be grown in minimal media for more reproducible induction of expression. Expression is induced in glycerolcontaining media by the addition of arabinose. Expression is repressed by addition of glucose or other catabolites. Cloned inserts must provide a translation initiation sequence (ATG) and ribosome binding site for expression. Expression of cloned inserts in the two recommended hosts differ in terms of induction characteristics, especially when using low concentrations of inducer (arabinose) and growing in minimal media. The following primers can be used for sequencing of cloned inserts: 5 primer (278bp upstream of the NheI site) :5 CTGTTTCTCCATACCCGTT 3and one of two 3 primers:3 primer 1 (219bp downstream of the HindIII site):5 CTCATCCGCCAAAACAG 33 primer 2 (1733bp downstream of the HindIII site):5 GGCTGAAAATCTTCTCT3




pBAD18 Sequence


LOCUS       Exported                4613 bp ds-DNA     circular SYN 11-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4613)
  TITLE     Direct Submission
  JOURNAL   Exported Sep 26, 2017 
FEATURES             Location/Qualifiers
     source          1..4613
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(96..974)
                     /product="L-arabinose regulatory protein"
     promoter        1001..1285
                     /label=araBAD promoter
                     /note="promoter of the L-arabinose operon of E. coli; the 
                     araC regulatory gene is transcribed in the opposite 
                     direction (Guzman et al., 1995)"
     misc_feature    1306..1362
                     /note="pUC18/19 multiple cloning site"
     terminator      1565..1651
                     /gene="Escherichia coli rrnB"
                     /label=rrnB T1 terminator
                     /note="transcription terminator T1 from the E. coli rrnB 
     terminator      1743..1770
                     /label=rrnB T2 terminator
                     /note="transcription terminator T2 from the E. coli rrnB 
     promoter        1789..1880
                     /label=AmpR promoter
     CDS             1881..2741
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2783..3238
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     rep_origin      3349..3937
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     misc_feature    4123..4263
                     /note="basis of mobility region from pBR322"
        1 atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac
       61 tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca
      121 ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta
      181 aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata
      241 ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag
      301 cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag
      361 caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg
      421 tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct
      481 tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc
      541 ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc
      601 gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca
      661 tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga
      721 tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa
      781 acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata
      841 taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc
      901 ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt
      961 tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat
     1021 tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta
     1081 accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt
     1141 aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca
     1201 ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta
     1261 tcgcaactct ctactgtttc tccatacccg tttttttggg ctagcgaatt cgagctcggt
     1321 acccggggat cctctagagt cgacctgcag gcatgcaagc ttggctgttt tggcggatga
     1381 gagaagattt tcagcctgat acagattaaa tcagaacgca gaagcggtct gataaaacag
     1441 aatttgcctg gcggcagtag cgcggtggtc ccacctgacc ccatgccgaa ctcagaagtg
     1501 aaacgccgta gcgccgatgg tagtgtgggg tctccccatg cgagagtagg gaactgccag
     1561 gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta tctgttgttt
     1621 gtcggtgaac gc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
