pBAD24 Plasmid


  • Model: PVT0709
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pBAD24,Plasmid pBAD24,pBAD24 vector


pBAD24 Information

Promoter: araBAD

Replicator: ori, F1 ori

Terminator: rrnB T1 Terminator

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pBAD series plasmid.

Plasmid size: 4542bp

Plasmid label: N-His, N-EK, N-Xpress

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, Top10 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression of host: LMG194 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: Arabia sugar

5'sequencing primers: PBAD30.F (AGATTAGCGGATCCTACCTG)

3'sequencing primers: PBAD30.R (CACTTCTGAGTTCGGCATGG)


pBAD24 Description

PBAD24 is derived from pBR322 vectors. The vector is designed to express and purify recombinant target protein in Escherichia coli in a dose-dependent manner. The E.coli araBAD promoter (pBAD) enhanced the soluble expression level of E.coli recombinant protein. Regulatory proteins AraC on pBAD/His and pBAD/Myc-His vectors can regulate pBad promoter.



pBAD24 Sequence

LOCUS       Exported File           4542 bp ds-DNA    circular SYN 02-2-2015
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4542)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-2-2  
FEATURES             Location/Qualifiers
     source          1..4542
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(96..974)
                     /product="L-arabinose regulatory protein"
     promoter        1120..1285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
     terminator      1569..1655
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      1747..1774
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        1793..1884
                     /note="AmpR promoter"
     CDS             1885..2745
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2787..3242
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     rep_origin      3353..3941
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
        1 atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac
       61 tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca
      121 ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta
      181 aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata
      241 ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag
      301 cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag
      361 caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg
      421 tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct
      481 tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc
      541 ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc
      601 gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca
      661 tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga
      721 tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa
      781 acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata
      841 taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc
      901 ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt
      961 tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat
     1021 tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta
     1081 accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt
     1141 aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca
     1201 ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta
     1261 tcgcaactct ctactgtttc tccatacccg tttttttggg ctagcaggag gaattcacca
     1321 tggtacccgg ggatcctcta gagtcgacct gcaggcatgc aagcttggct gttttggcgg
     1381 atgagagaag attttcagcc tgatacagat taaatcagaa cgcagaagcg gtctgataaa
     1441 acagaatttg cctggcggca gtagcgcggt ggtcccacct gaccccatgc cgaactcaga
     1501 agtgaaacgc cgtagcgccg atggtagtgt ggggtctccc catgcgagag tagggaactg
     1561 ccaggcatca aataaaacga aaggctcagt cgaaagactg ggcctttcgt tttatctgtt
     1621 gtttgtcggt gaacgctctc ctgagtagga caaatccgcc gggagcggat ttgaacgttg
     1681 cgaagcaacg gcccggaggg tggcgggcag gacgcccgcc ataaactgcc aggcatcaaa
     1741 ttaagcagaa ggccatcctg acggatggcc tttttgcgtt tctacaaact cttttgttta
     1801 tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt
     1861 caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc
     1921 ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt gaaagtaaaa
     1981 gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct caacagcggt
     2041 aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt
     2101 ctgctatgtg gcgcggtatt atcccgtgtt gacgccgggc aagagcaact cggtcgccgc
     2161 atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg
     2221 gatggcatga cagtaagaga attatgcagt gctgccataa ccatgagtga taacactgcg
     2281 gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt tttgcacaac
     2341 atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga agccatacca
     2401 aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta
     2461 actggcgaac tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat
     2521 aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
