pBAD30 Plasmid


  • Model: PVT0710
  • 50 Units in Stock
Ask a question

Add to Cart:

pBAD30 Plasmid

PVT0710       2ug

pBAD30 plasmid information

Promoter: araC

Replicator: p15A ori, F1 ori

Plasmid classification: Escherichia coli vector; pBAD series expression plasmid

Plasmid size: 4919bp

Prokaryotic resistance: ampicillin Amp

Cloned strain: Top10

Culture conditions: 37 centigrade, aerobic, LB

Expressing the host: recommending LMG194

Culture conditions: 37 centigrade, aerobic, LB

Inducement: Arabia sugar

5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC

3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG

Growth Strain:DH5a

pBAD30 Plasmid  Description

pBAD30 Plasmid


pBAD30 Plasmid Sequence

LOCUS       Exported                4919 bp ds-DNA     circular SYN 12-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4919)
  TITLE     Direct Submission
  JOURNAL   Exported Monday, September 12, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4919
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(96..974)
                     /product="L-arabinose regulatory protein"
     promoter        1001..1285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
                     direction (Guzman et al., 1995)"
     misc_feature    1306..1362
                     /note="pUC18/19 multiple cloning site"
     terminator      1565..1651
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      1743..1770
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        1789..1880
                     /note="AmpR promoter"
     CDS             1881..2741
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2783..3238
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     rep_origin      complement(4199..4744)
                     /note="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
        1 atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac
       61 tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca
      121 ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta
      181 aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata
      241 ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag
      301 cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag
      361 caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg
      421 tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct
      481 tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc
      541 ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc
      601 gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca
      661 tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga
      721 tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa
      781 acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata
      841 taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc
      901 ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt
      961 tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat
     1021 tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta
     1081 accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt
     1141 aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca
     1201 ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta
     1261 tcgcaactct ctactgtttc tccatacccg tttttttggg ctagcgaatt cgagctcggt
     1321 acccggggat cctctagagt cgacctgcag gcatgcaagc ttggctgttt tggcggatga
     1381 gagaagattt tcagcctgat acagattaaa tcagaacgca gaagcggtct gataaaacag
     1441 aatttgcctg gcggcagtag cgcggtggtc ccacctgacc ccatgccgaa ctcagaagtg
     1501 aaacgccgta gcgccgatgg tagtgtgggg tctccccatg cgagagtagg gaactgccag
     1561 gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta tctgttgttt
     1621 gtcggtgaac gctctcctga gtaggacaaa tccgccggga gcggatttga acgttgcgaa
     1681 gcaacggccc ggagggtggc gggcaggacg cccgccataa actgccaggc atcaaattaa
     1741 gcagaaggcc atcctgacgg atggcctttt tgcgtttcta caaactcttt tgtttatttt
     1801 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat
     1861 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt
     1921 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
     1981 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga
     2041 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc
     2101 tatgtggcgc ggtattatcc cgtgttgacg ccgggcaaga gcaactcggt cgccgcatac
     2161 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg
     2221 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca
     2281 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg
     2341 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg
     2401 acgagcgtga caccacgatg cctgcagcaa tggcaacaac gttgcgcaaa ctattaactg
     2461 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag
     2521 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg
     2581 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct
     2641 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac
     2701 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact
     2761 catatatact ttagattgat ttacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg
     2821 gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc tcctttcgct
     2881 ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct aaatcggggg
     2941 ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa acttgatttg
     3001 ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc tttgacgttg
     3061 gagtccacgt tctttaatag tggactcttg ttccaaactt gaacaacact caaccctatc
     3121 tcgggctatt cttttgattt ataagggatt ttgccgattt cggcctattg gttaaaaaat
     3181 gagctgattt aacaaaaatt taacgcgaat tttaacaaaa tattaacgtt tacaatttaa
     3241 aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt
     3301 ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt
     3361 ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg
     3421 tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca
     3481 gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt
     3541 agcaccgcct acatacctcg ctctgctaat cctgttacca gtcaggcatt tgagaagcac
     3601 acggtcacac tgcttccggt agtcaataaa ccggtaaacc agcaatagac ataagcggct
     3661 atttaacgac cctgccctga accgacgacc gggtcgaatt tgctttcgaa tttctgccat
     3721 tcatccgctt attatcactt attcaggcgt agcaccaggc gtttaagggc accaataact
     3781 gccttaaaaa aattacgccc cgccctgcca ctcatcgcag tactgttgta attcattaag
     3841 cattctgccg acatggaagc catcacagac ggcatgatga acctgaatcg ccagcggcat
     3901 cagcaccttg tcgccttgcg tataatattt gccgctagcg gagtgtatac tggcttacta
     3961 tgttggcact gatgagggtg tcagtgaagt gcttcatgtg gcaggagaaa aaaggctgca
     4021 ccggtgcgtc agcagaatat gtgatacagg atatattccg cttcctcgct cactgactcg
     4081 ctacgctcgg tcgttcgact gcggcgagcg gaaatggctt acgaacgggg cggagatttc
     4141 ctggaagatg ccaggaagat acttaacagg gaagtgagag ggccgcggca aagccgtttt
     4201 tccataggct ccgcccccct gacaagcatc acgaaatctg acgctcaaat cagtggtggc
     4261 gaaacccgac aggactataa agataccagg cgtttccccc tggcggctcc ctcgtgcgct
     4321 ctcctgttcc tgcctttcgg tttaccggtg tcattccgct gttatggccg cgtttgtctc
     4381 attccacgcc tgacactcag ttccgggtag gcagttcgct ccaagctgga ctgtatgcac
     4441 gaaccccccg ttcagtccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac
     4501 ccggaaagac atgcaaaagc accactggca gcagccactg gtaattgatt tagaggagtt
     4561 agtcttgaag tcatgcgccg gttaaggcta aactgaaagg acaagttttg gtgactgcgc
     4621 tcctccaagc cagttacctc ggttcaaaga gttggtagct cagagaacct tcgaaaaacc
     4681 gccctgcaag gcggtttttt cgttttcaga gcaagagatt acgcgcagac caaaacgatc
     4741 tcaagaagat catcttatta atcagataaa atatttgctc atgagcccga agtggcgagc
     4801 ccgatcttcc ccatcggtga tgtcggcgat ataggcgcca gcaaccgcac ctgtggcgcc
     4861 ggtgatgccg gccacgatgc gtccggcgta gaggatctgc tcatgtttga cagcttatc

Product is for research use only!


Search name

pBAD30,Plasmid pBAD30,pBAD30 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
