pBAD33 Plasmid


  • Model: PVT0711
  • 49 Units in Stock
Ask a question

Add to Cart:

pBAD33 Plasmid

PVT0711      2ug

pBAD33 plasmid Infomation

Promoter: araBAD
Plasmid classification: Escherichia coli vector; pBAD series expression plasmid
Plasmid size: 5352bp
Prokaryotic resistance: chloramphenicol Chl
Cloned strain: Top10
Culture conditions: 37 centigrade, aerobic, LB
Expressing the host: recommending LMG194
Culture conditions: 37 centigrade, aerobic, LB
Inducement: Arabia sugar
5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC
3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG

pBAD33 plasmid Descrption
PBAD33 is a pBAD series expression plasmid of Escherichia coli.


pBAD33 plasmid Sequence
LOCUS       Exported                5352 bp ds-DNA    circular SYN 17-9-2015
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5352)
  AUTHORS   admin
  TITLE     Direct Submission
  JJOURNAL   Exported 2015-9-17  
FEATURES             Location/Qualifiers
     source          1..5352
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(96..974)
                     /product="L-arabinose regulatory protein"
     promoter        1120..1285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
     misc_feature    1306..1362
                     /note="pUC18/19 multiple cloning site"
     terminator      1565..1651
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      1743..1770
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        1789..1880
                     /note="AmpR promoter"
     rep_origin      2334..2789
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     CDS             complement(3344..4003)
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     promoter        complement(4004..4106)
                     /note="cat promoter"
                     /note="promoter of the E. coli cat gene"
     rep_origin      complement(4632..5177)
                     /note="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
        1 atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac
       61 tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca
      121 ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta
      181 aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata
      241 ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag
      301 cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag
      361 caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg
      421 tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct
      481 tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc
      541 ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc
      601 gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca
      661 tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga
      721 tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa
      781 acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata
      841 taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc
      901 ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt
      961 tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat
     1021 tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta
     1081 accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt
     1141 aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca
     1201 ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta
     1261 tcgcaactct ctactgtttc tccatacccg tttttttggg ctagcgaatt cgagctcggt
     1321 acccggggat cctctagagt cgacctgcag gcatgcaagc ttggctgttt tggcggatga
     1381 gagaagattt tcagcctgat acagattaaa tcagaacgca gaagcggtct gataaaacag
     1441 aatttgcctg gcggcagtag cgcggtggtc ccacctgacc ccatgccgaa ctcagaagtg
     1501 aaacgccgta gcgccgatgg tagtgtgggg tctccccatg cgagagtagg gaactgccag
     1561 gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta tctgttgttt
     1621 gtcggtgaac gctctcctga gtaggacaaa tccgccggga gcggatttga acgttgcgaa
     1681 gcaacggccc ggagggtggc gggcaggacg cccgccataa actgccaggc atcaaattaa
     1741 gcagaaggcc atcctgacgg atggcctttt tgcgtttcta caaactcttt tgtttatttt
     1801 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat
     1861 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt
     1921 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
     1981 ctgaagatca gttggggcaa actattaact ggcgaactac ttactctagc ttcccggcaa
     2041 caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt
     2101 ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc
     2161 attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg
     2221 agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt
     2281 aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttacgcgcc
     2341 ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact
     2401 tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg ccacgttcgc
     2461 cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt
     2521 acggcacctc gaccccaaaa aacttgattt gggtgatggt tcacgtagtg ggccatcgcc
     2581 ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt
     2641 gttccaaact tgaacaacac tcaaccctat ctcgggctat tcttttgatt tataagggat
     2701 tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa
     2761 ttttaacaaa atattaacgt ttacaattta aaaggatcta ggtgaagatc ctttttgata
     2821 atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag
     2881 aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa
     2941 caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt
     3001 ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc
     3061 cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa
     3121 tcctgttacc agtcaggcat ttgagaagca cacggtcaca ctgcttccgg tagtcaataa
     3181 accggtaaac cagcaataga cataagcggc tatttaacga ccctgccctg aaccgacgac
     3241 cgggtcgaat ttgctttcga atttctgcca ttcatccgct tattatcact tattcaggcg
     3301 tagcaccagg cgtttaaggg caccaataac tgccttaaaa aaattacgcc ccgccctgcc
     3361 actcatcgca gtactgttgt aattcattaa gcattctgcc gacatggaag ccatcacaga
     3421 cggcatgatg aacctgaatc gccagcggca tcagcacctt gtcgccttgc gtataatatt
     3481 tgcccatggt gaaaacgggg gcgaagaagt tgtccatatt ggccacgttt aaatcaaaac
     3541 tggtgaaact cacccaggga ttggctgaga cgaaaaacat attctcaata aaccctttag
     3601 ggaaataggc caggttttca ccgtaacacg ccacatcttg cgaatatatg tgtagaaact
     3661 gccggaaatc gtcgtggtat tcactccaga gcgatgaaaa cgtttcagtt tgctcatgga
     3721 aaacggtgta acaagggtga acactatccc atatcaccag ctcaccgtct ttcattgcca
     3781 tacggaattc cggatgagca ttcatcaggc gggcaagaat gtgaataaag gccggataaa
     3841 acttgtgctt atttttcttt acggtcttta aaaaggccgt aatatccagc tgaacggtct
     3901 ggttataggt acattgagca actgactgaa atgcctcaaa atgttcttta cgatgccatt
     3961 gggatatatc aacggtggta tatccagtga tttttttctc cattttagct tccttagctc
     4021 ctgaaaatct cgataactca aaaaatacgc ccggtagtga tcttatttca ttatggtgaa
     4081 agttggaacc tcttacgtgc cgatcaacgt ctcattttcg ccaaaagttg gcccagggct
     4141 tcccggtatc aacagggaca ccaggattta tttattctgc gaagtgatct tccgtcacag
     4201 gtatttattc ggcgcaaagt gcgtcgggtg atgctgccaa cttactgatt tagtgtatga
     4261 tggtgttttt gaggtgctcc agtggcttct gtttctatca gctgtccctc ctgttcagct
     4321 actgacgggg tggtgcgtaa cggcaaaagc accgccggac atcagcgcta gcggagtgta
     4381 tactggctta ctatgttggc actgatgagg gtgtcagtga agtgcttcat gtggcaggag
     4441 aaaaaaggct gcaccggtgc gtcagcagaa tatgtgatac aggatatatt ccgcttcctc
     4501 gctcactgac tcgctacgct cggtcgttcg actgcggcga gcggaaatgg cttacgaacg
     4561 gggcggagat ttcctggaag atgccaggaa gatacttaac agggaagtga gagggccgcg
     4621 gcaaagccgt ttttccatag gctccgcccc cctgacaagc atcacgaaat ctgacgctca
     4681 aatcagtggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggcggc
     4741 tccctcgtgc gctctcctgt tcctgccttt cggtttaccg gtgtcattcc gctgttatgg
     4801 ccgcgtttgt ctcattccac gcctgacact cagttccggg taggcagttc gctccaagct
     4861 ggactgtatg cacgaacccc ccgttcagtc cgaccgctgc gccttatccg gtaactatcg
     4921 tcttgagtcc aacccggaaa gacatgcaaa agcaccactg gcagcagcca ctggtaattg
     4981 atttagagga gttagtcttg aagtcatgcg ccggttaagg ctaaactgaa aggacaagtt
     5041 ttggtgactg cgctcctcca agccagttac ctcggttcaa agagttggta gctcagagaa
     5101 ccttcgaaaa accgccctgc aaggcggttt tttcgttttc agagcaagag attacgcgca
     5161 gaccaaaacg atctcaagaa gatcatctta ttaatcagat aaaatatttg ctcatgagcc
     5221 cgaagtggcg agcccgatct tccccatcgg tgatgtcggc gatataggcg ccagcaaccg
     5281 cacctgtggc gccggtgatg ccggccacga tgcgtccggc gtagaggatc tgctcatgtt
     5341 tgacagctta tc


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
