pBAD33 Plasmid


  • Model: PVT0711
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pBAD33,Plasmid pBAD33,pBAD33 vector

pBAD33 plasmid Infomation

Promoter: araBAD
Plasmid classification: Escherichia coli vector; pBAD series expression plasmid
Plasmid size: 5352bp
Prokaryotic resistance: chloramphenicol Chl
Cloned strain: Top10
Culture conditions: 37 centigrade, aerobic, LB
Expressing the host: recommending LMG194
Culture conditions: 37 centigrade, aerobic, LB
Inducement: Arabia sugar
5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC
3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG

pBAD33 plasmid Descrption
PBAD33 is a pBAD series expression plasmid of Escherichia coli.


pBAD33 plasmid Sequence
LOCUS       Exported                5352 bp ds-DNA    circular SYN 17-9-2015
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5352)
  AUTHORS   admin
  TITLE     Direct Submission
  JJOURNAL   Exported 2015-9-17  
FEATURES             Location/Qualifiers
     source          1..5352
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(96..974)
                     /product="L-arabinose regulatory protein"
     promoter        1120..1285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
     misc_feature    1306..1362
                     /note="pUC18/19 multiple cloning site"
     terminator      1565..1651
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      1743..1770
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        1789..1880
                     /note="AmpR promoter"
     rep_origin      2334..2789
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     CDS             complement(3344..4003)
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     promoter        complement(4004..4106)
                     /note="cat promoter"
                     /note="promoter of the E. coli cat gene"
     rep_origin      complement(4632..5177)
                     /note="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
        1 atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac
       61 tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca
      121 ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta
      181 aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata
      241 ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag
      301 cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag
      361 caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg
      421 tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct
      481 tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc
      541 ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc
      601 gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca
      661 tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga
      721 tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa
      781 acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata
      841 taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc
      901 ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt
      961 tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat
     1021 tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta
     1081 accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt
     1141 aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca
     1201 ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta
     1261 tcgcaactct ctactgtttc tccatacccg tttttttggg ctagcgaatt cgagctcggt
     1321 acccggggat cctctagagt cgacctgcag gcatgcaagc ttggctgttt tggcggatga
     1381 gagaagattt tcagcctgat acagattaaa tcagaacgca gaagcggtct gataaaacag
     1441 aatttgcctg gcggcagtag cgcggtggtc ccacctgacc ccatgccgaa ctcagaagtg
     1501 aaacgccgta gcgccgatgg tagtgtgggg tctccccatg cgagagtagg gaactgccag
     1561 gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta tctgttgttt
     1621 gtcggtgaac gctctcctga gtaggacaaa tccgccggga gcggatttga acgttgcgaa
     1681 gcaacggccc ggagggtggc gggcaggacg cccgccataa actgccaggc atcaaattaa
     1741 gcagaaggcc atcctgacgg atggcctttt tgcgtttcta caaactcttt tgtttatttt
     1801 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat
     1861 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt
     1921 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
     1981 ctgaagatca gttggggcaa actattaact ggcgaactac ttactctagc ttcccggcaa
     2041 caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt
     2101 ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc
     2161 attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacg

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
