pBAD43 Plasmid


  • Model: PVT0712
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pBAD43,Plasmid pBAD43,pBAD43 vector


pBAD43 Information

Promoter: araBAD

Replicon: pSC101 ori

Plasmid classification: Escherichia coli vector; pBAD series expression plasmid

Plasmid size: 6179bp

Prokaryotic resistance: splendin Spe

Cloned strain: Top10

Culture conditions: 37 centigrade, aerobic, LB

Expressing the host: recommending LMG194

Culture conditions: 37 centigrade, aerobic, LB

Inducement: Arabia sugar

5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC

3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG


pBAD43 Description

PBAD43 is a pBAD series expression plasmid of Escherichia coli.



pBAD43 Sequence

LOCUS       Exported                6179 bp ds-DNA    circular SYN 17-9-2015
KEYWORDS    Untitled 4
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6179)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-9-17   
FEATURES             Location/Qualifiers
     source          1..6179
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(191..1069)
                     /product="L-arabinose regulatory protein"
     promoter        1215..1380
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
     terminator      1664..1750
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      1842..1869
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     primer_bind     complement(1950..1966)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
     CDS             complement(2489..3280)
                     /product="aminoglycoside adenylyltransferase (Murphy,
                     /note="confers resistance to spectinomycin and
     CDS             complement(4314..5264)
                     /product="protein needed for replication with the pSC101
     rep_origin      5312..5534
                     /note="pSC101 ori"
                     /note="low-copy replication origin that requires the Rep101
     protein_bind    6099..6120
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        6135..6165
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
        1 cctgatatag gcgccagcaa ccgcacctgt ggcgccggtg atgccggcca cgatgcgtcc
       61 ggcgtagagg atctgctcat gtttgacagc ttatcatcga tgcataatgt gcctgtcaaa
      121 tggacgaagc agggattctg caaaccctat gctactccgt caagccgtca attgtctgat
      181 tcgttaccaa ttatgacaac ttgacggcta catcattcac tttttcttca caaccggcac
      241 ggaactcgct cgggctggcc ccggtgcatt ttttaaatac ccgcgagaaa tagagttgat
      301 cgtcaaaacc aacattgcga ccgacggtgg cgataggcat ccgggtggtg ctcaaaagca
      361 gcttcgcctg gctgatacgt tggtcctcgc gccagcttaa gacgctaatc cctaactgct
      421 ggcggaaaag atgtgacaga cgcgacggcg acaagcaaac atgctgtgcg acgctggcga
      481 tatcaaaatt gctgtctgcc aggtgatcgc tgatgtactg acaagcctcg cgtacccgat
      541 tatccatcgg tggatggagc gactcgttaa tcgcttccat gcgccgcagt aacaattgct
      601 caagcagatt tatcgccagc agctccgaat agcgcccttc cccttgcccg gcgttaatga
      661 tttgcccaaa caggtcgctg aaatgcggct ggtgcgcttc atccgggcga aagaaccccg
      721 tattggcaaa tattgacggc cagttaagcc attcatgcca gtaggcgcgc ggacgaaagt
      781 aaacccactg gtgataccat tcgcgagcct ccggatgacg accgtagtga tgaatctctc
      841 ctggcgggaa cagcaaaata tcacccggtc ggcaaacaaa ttctcgtccc tgatttttca
      901 ccaccccctg accgcgaatg gtgagattga gaatataacc tttcattccc agcggtcggt
      961 cgataaaaaa atcgagataa ccgttggcct caatcggcgt taaacccgcc accagatggg
     1021 cattaaacga gtatcccggc agcaggggat cattttgcgc ttcagccata cttttcatac
     1081 tcccgccatt cagagaagaa accaattgtc catattgcat cagacattgc cgtcactgcg
     1141 tcttttactg gctcttctcg ctaaccaaac cggtaacccc gcttattaaa agcattctgt
     1201 aacaaagcgg gaccaaagcc atgacaaaaa cgcgtaacaa aagtgtctat aatcacggca
     1261 gaaaagtcca cattgattat ttgcacggcg tcacactttg ctatgccata gcatttttat
     1321 ccataagatt agcggatcct acctgacgct ttttatcgca actctctact gtttctccat
     1381 acccgttttt ttgggctagc aggaggaatt caccatggta cccggggatc ctctagagtc
     1441 gacctgcagg catgcaagct tggctgtttt ggcggatgag agaagatttt cagcctgata
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
