pBAD43 Plasmid


  • Model: PVT0712
  • 49 Units in Stock
Ask a question

Add to Cart:


PVT0712  2ug


pBAD43 Information

Promoter: araBAD

Replicon: pSC101 ori

Plasmid classification: Escherichia coli vector; pBAD series expression plasmid

Plasmid size: 6179bp

Prokaryotic resistance: splendin Spe

Cloned strain: Top10

Culture conditions: 37 centigrade, aerobic, LB

Expressing the host: recommending LMG194

Culture conditions: 37 centigrade, aerobic, LB

Inducement: Arabia sugar

5'sequencing primers: pBAD-F: ATGCCATAGCATTTTTATCC

3'sequencing primers: pBAD-R: GATTTAATCTGTATCAGG


pBAD43 Description

PBAD43 is a pBAD series expression plasmid of Escherichia coli.



pBAD43 Sequence

LOCUS       Exported                6179 bp ds-DNA    circular SYN 17-9-2015
KEYWORDS    Untitled 4
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6179)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-9-17   
FEATURES             Location/Qualifiers
     source          1..6179
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(191..1069)
                     /product="L-arabinose regulatory protein"
     promoter        1215..1380
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
     terminator      1664..1750
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      1842..1869
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     primer_bind     complement(1950..1966)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
     CDS             complement(2489..3280)
                     /product="aminoglycoside adenylyltransferase (Murphy,
                     /note="confers resistance to spectinomycin and
     CDS             complement(4314..5264)
                     /product="protein needed for replication with the pSC101
     rep_origin      5312..5534
                     /note="pSC101 ori"
                     /note="low-copy replication origin that requires the Rep101
     protein_bind    6099..6120
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        6135..6165
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"ORIGIN
        1 cctgatatag gcgccagcaa ccgcacctgt ggcgccggtg atgccggcca cgatgcgtcc
       61 ggcgtagagg atctgctcat gtttgacagc ttatcatcga tgcataatgt gcctgtcaaa
      121 tggacgaagc agggattctg caaaccctat gctactccgt caagccgtca attgtctgat
      181 tcgttaccaa ttatgacaac ttgacggcta catcattcac tttttcttca caaccggcac
      241 ggaactcgct cgggctggcc ccggtgcatt ttttaaatac ccgcgagaaa tagagttgat
      301 cgtcaaaacc aacattgcga ccgacggtgg cgataggcat ccgggtggtg ctcaaaagca
      361 gcttcgcctg gctgatacgt tggtcctcgc gccagcttaa gacgctaatc cctaactgct
      421 ggcggaaaag atgtgacaga cgcgacggcg acaagcaaac atgctgtgcg acgctggcga
      481 tatcaaaatt gctgtctgcc aggtgatcgc tgatgtactg acaagcctcg cgtacccgat
      541 tatccatcgg tggatggagc gactcgttaa tcgcttccat gcgccgcagt aacaattgct
      601 caagcagatt tatcgccagc agctccgaat agcgcccttc cccttgcccg gcgttaatga
      661 tttgcccaaa caggtcgctg aaatgcggct ggtgcgcttc atccgggcga aagaaccccg
      721 tattggcaaa tattgacggc cagttaagcc attcatgcca gtaggcgcgc ggacgaaagt
      781 aaacccactg gtgataccat tcgcgagcct ccggatgacg accgtagtga tgaatctctc
      841 ctggcgggaa cagcaaaata tcacccggtc ggcaaacaaa ttctcgtccc tgatttttca
      901 ccaccccctg accgcgaatg gtgagattga gaatataacc tttcattccc agcggtcggt
      961 cgataaaaaa atcgagataa ccgttggcct caatcggcgt taaacccgcc accagatggg
     1021 cattaaacga gtatcccggc agcaggggat cattttgcgc ttcagccata cttttcatac
     1081 tcccgccatt cagagaagaa accaattgtc catattgcat cagacattgc cgtcactgcg
     1141 tcttttactg gctcttctcg ctaaccaaac cggtaacccc gcttattaaa agcattctgt
     1201 aacaaagcgg gaccaaagcc atgacaaaaa cgcgtaacaa aagtgtctat aatcacggca
     1261 gaaaagtcca cattgattat ttgcacggcg tcacactttg ctatgccata gcatttttat
     1321 ccataagatt agcggatcct acctgacgct ttttatcgca actctctact gtttctccat
     1381 acccgttttt ttgggctagc aggaggaatt caccatggta cccggggatc ctctagagtc
     1441 gacctgcagg catgcaagct tggctgtttt ggcggatgag agaagatttt cagcctgata
     1501 cagattaaat cagaacgcag aagcggtctg ataaaacaga atttgcctgg cggcagtagc
     1561 gcggtggtcc cacctgaccc catgccgaac tcagaagtga aacgccgtag cgccgatggt
     1621 agtgtggggt ctccccatgc gagagtaggg aactgccagg catcaaataa aacgaaaggc
     1681 tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg tcggtgaacg ctctcctgag
     1741 taggacaaat ccgccgggag cggatttgaa cgttgcgaag caacggcccg gagggtggcg
     1801 ggcaggacgc ccgccataaa ctgccaggca tcaaattaag cagaaggcca tcctgacgga
     1861 tggccttttt gcgtttctac aaactctttt gtttattttt ctaaatacat tcaaatatgt
     1921 atccgctcat gagacaataa ccctagctta ctggccgtcg ttttacaacg tcgtgactgg
     1981 gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg
     2041 cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc
     2101 gaatggcgcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcata
     2161 tggtgcactc tcagtacaat ctgctctgat gccgcatagt taagccagcc ccgacacccg
     2221 ccaacacccg ctgacgagct tagtaaagcc ctcgctagat tttaatgcgg atgttgcgat
     2281 tacttcgcca actattgcga taacaagaaa aagccagcct ttcatgatat atctcccaat
     2341 ttgtgtaggg cttattatgc acgcttaaaa ataataaaag cagacttgac ctgatagttt
     2401 ggctgtgagc aattatgtgc ttagtgcatc taacgcttga gttaagccgc gccgcgaagc
     2461 ggcgtcggct tgaacgaatt gttagacatt atttgccgac taccttggtg atctcgcctt
     2521 tcacgtagtg gacaaattct tccaactgat ctgcgcgcga ggccaagcga tcttcttctt
     2581 gtccaagata agcctgtcta gcttcacgta tgacgggctg atactgggcc ggcaggcgct
     2641 ccattgccca gtcggcagcg acctccttcg gcgcgatttt gccggttact gcgctgtacc
     2701 aaatgcggga caacgtaagc actacatttc gctcatcgcc agcccagtcg ggcggcgagt
     2761 tccatagcgt taaggtttca tttagcgcct caaatagatc ctgttcagga accggatcaa
     2821 agagttcctc cgccgctgga cctaccaagg caacgctatg ttctcttgct tttgtcagca
     2881 agatagccag atcaatgtcg atcgtggctg gctcgaagat acctgcaaga atgtcattgc
     2941 gctgccattc tccaaattgc agttcgcgct tagctggata acgccacgga atgatgtcgt
     3001 cgtgcacaac aatggtgact tctacagcgc ggagaatctc gctctctcca ggggaagccg
     3061 aagtttccaa aaggtcgttg atcaaagctc gccgcgttgt ttcatcaagc cttacggtca
     3121 ccgtaaccag caaatcaata tcactgtgtg gcttcaggcc gccatccact gcggagccgt
     3181 acaaatgtac ggccagcaac gtcggttcga gatggcgctc gatgacgcca actacctctg
     3241 atagttgagt cgatacttcg gcgatcaccg cttccctcat gatgtttaac tttgttttag
     3301 ggcgactgcc ctgctgcgta acatcgttgc tgctccataa catcaaacat cgacccacgg
     3361 cgtaacgcgc ttgctgcttg gatgcccgag gcatagactg taccccaaaa aaacagtcat
     3421 aacaagccat gaaaaccgcc actgcgccgt taccaccgct gcgttcggtc aaggttctgg
     3481 accagttgcg tgagcgcata cgctacttgc attacagctt acgaaccgaa caggcttatg
     3541 tccactgggt tcgtgccttc atccgtttcc acggtgtgcg tcacccggca accttgggca
     3601 gcagcgaagt cgaggcattt ctgtcctggc tggcgaacga gcgcaaggtt tcggtctcca
     3661 cgcatcgtca ggcattggcg gccttgctgt tcttctacgg caaggtgctg tgcacggatc
     3721 tgccctggct tcaggagatc ggaagacctc ggccgtcgcg gcgcttgccg gtggtgctga
     3781 ccccggatga agtaattccc acgggttttg ctgcccgcaa acgggctgtt ctggtgttgc
     3841 tagtttgtta tcagaatcgc agatccggct tcaggtttgc cggctgaaag cgctatttct
     3901 tccagaattg ccatgatttt ttccccacgg gaggcgtcac tggctcccgt gttgtcggca
     3961 gctttgattc gataagcagc atcgcctgtt tcaggctgtc tatgtgtgac tgttgagctg
     4021 taacaagttg tctcaggtgt tcaatttcat gttctagttg ctttgtttta ctggtttcac
     4081 ctgttctatt aggtgttaca tgctgttcat ctgttacatt gtcgatctgt tcatggtgaa
     4141 cagctttgaa tgcaccaaaa actcgtaaaa gctctgatgt atctatcttt tttacaccgt
     4201 tttcatctgt gcatatggac agttttccct ttgatatgta acggtgaaca gttgttctac
     4261 ttttgtttgt tagtcttgat gcttcactga tagatacaag agccataaga acctcagatc
     4321 cttccgtatt tagccagtat gttctctagt gtggttcgtt gtttttgcgt gagccatgag
     4381 aacgaaccat tgagatcata cttactttgc atgtcactca aaaattttgc ctcaaaactg
     4441 gtgagctgaa tttttgcagt taaagcatcg tgtagtgttt ttcttagtcc gttatgtagg
     4501 taggaatctg atgtaatggt tgttggtatt ttgtcaccat tcatttttat ctggttgttc
     4561 tcaagttcgg ttacgagatc catttgtcta tctagttcaa cttggaaaat caacgtatca
     4621 gtcgggcggc ctcgcttatc aaccaccaat ttcatattgc tgtaagtgtt taaatcttta
     4681 cttattggtt tcaaaaccca ttggttaagc cttttaaact catggtagtt attttcaagc
     4741 attaacatga acttaaattc atcaaggcta atctctatat ttgccttgtg agttttcttt
     4801 tgtgttagtt cttttaataa ccactcataa atcctcatag agtatttgtt ttcaaaagac
     4861 ttaacatgtt ccagattata ttttatgaat ttttttaact ggaaaagata aggcaatatc
     4921 tcttcactaa aaactaattc taatttttcg cttgagaact tggcatagtt tgtccactgg
     4981 aaaatctcaa agcctttaac caaaggattc ctgatttcca cagttctcgt catcagctct
     5041 ctggttgctt tagctaatac accataagca ttttccctac tgatgttcat catctgagcg
     5101 tattggttat aagtgaacga taccgtccgt tctttccttg tagggttttc aatcgtgggg
     5161 ttgagtagtg ccacacagca taaaattagc ttggtttcat gctccgttaa gtcatagcga
     5221 ctaatcgcta gttcatttgc tttgaaaaca actaattcag acatacatct caattggtct
     5281 aggtgatttt aatcactata ccaattgaga tgggctagtc aatgataatt actagtcctt
     5341 ttcctttgag ttgtgggtat ctgtaaattc tgctagacct ttgctggaaa acttgtaaat
     5401 tctgctagac cctctgtaaa ttccgctaga cctttgtgtg ttttttttgt ttatattcaa
     5461 gtggttataa tttatagaat aaagaaagaa taaaaaaaga taaaaagaat agatcccagc
     5521 cctgtgtata actcactact ttagtcagtt ccgcagtatt acaaaaggat gtcgcaaacg
     5581 ctgtttgctc ctctacaaaa cagaccttaa aaccctaaag gcttaagtag caccctcgca
     5641 agctcgggca aatcgctgaa tattcctttt gtctccgacc atcaggcacc tgagtcgctg
     5701 tctttttcgt gacattcagt tcgctgcgct cacggctctg gcagtgaatg ggggtaaatg
     5761 gcactacagg cgccttttat ggattcatgc aaggaaacta cccataatac aagaaaagcc
     5821 cgtcacgggc ttctcagggc gttttatggc gggtctgcta tgtggtgcta tctgactttt
     5881 tgctgttcag cagttcctgc cctctgattt tccagtctga ccacttcgga ttatcccgtg
     5941 acaggtcatt cagactggct aatgcaccca gtaaggcagc ggtatcatca acaggcttac
     6001 ccgtcttact gtcgggaatt aattcgttgg ccgattcatt aatgcagctg gcacgacagg
     6061 tttcccgact ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta gctcactcat
     6121 taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgag


Search name

pBAD43,Plasmid pBAD43,pBAD43 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
