pBAD/His B


  • Model: PVTY00913
  • 20 Units in Stock
Ask a question

Add to Cart:

pBAD/His B

PVTY00913  2ug

pBAD/His B Description

Plasmid type: E.coli Expression Vector Copy number: High copy Promoter: araBad Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4092 bp 5' Sequencing primers and sequences: pBAD-F: ATGCCATAGCATTTTTATCC 3' Sequencing primers and sequences: pBAD-R: gatttaatctgtatcagg Tags: N-His, N-EK Resistance(s): Ampicillin (Amp)

1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
