pBad/Myc-His C

$280.00

  • Model: PVTY00917
  • 20 Units in Stock
Ask a question


Add to Cart:

pBad/Myc-His C

PVTY00917  2ug

pBad/Myc-His C Description

Plasmid type: E.coli Expression Vector Copy number: High copy Promoter: araBad Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4093 bp 5' Sequencing primers and sequences: pBAD-F: ATGCCATAGCATTTTTATCC 3' Sequencing primers and sequences: pBAD-R: gatttaatctgtatcagg Tags: C-His, C-Myc Resistance(s): Ampicillin (Amp)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart