pBBR1MCS5-Tac-EGFP

$312.00

  • Model: PVT18890
  • 50 Units in Stock
Ask a question


Add to Cart:

pBBR1MCS5-Tac-EGFP

 

Product Name: pBBR1MCS5-Tac-EGFP
Cat No.: PVT18890
Alternative Name: pBBR1MCS5-Tac-EGFP,pBBR1MCS5-Tac-EGFP vector,pBBR1MCS5-Tac-EGFP plasmid,pBBR1MCS5-Tac-EGFP map,pBBR1MCS5-Tac-EGFP sequence
Plasmid form: Freeze-dried powder
Storage Condition: -20 Centigrade
Bulk order Please contact us: sales@lifescience-market.com
Promoter: Tac
Bacterial Resistance(s): Gen
Screening: EGFP
Growth Strain(s): DH5alpha
Culture Medium: LB
Temperature: 37 Centigrade
Vector Size: 5539bp

 

pBBR1MCS5-Tac-EGFP Sequence

CTCGGGCCGTCTCTTGGGCTTGATCGGCCTTCTTGCGCATCTCACGCGCTCCTGCGGCGGCCTGTAGGGCAGGCTCATAC
CCCTGCCGAACCGCTTTTGTCAGCCGGTCGGCCACGGCTTCCGGCGTCTCAACGCGCTTTGAGATTCCCAGCTTTTCGGC
CAATCCCTGCGGTGCATAGGCGCGTGGCTCGACCGCTTGCGGGCTGATGGTGACGTGGCCCACTGGTGGCCGCTCCAGGG
CCTCGTAGAACGCCTGAATGCGCGTGTGACGTGCCTTGCTGCCCTCGATGCCCCGTTGCAGCCCTAGATCGGCCACAGCG
GCCGCAAACGTGGTCTGGTCGCGGGTCATCTGCGCTTTGTTGCCGATGAACTCCTTGGCCGACAGCCTGCCGTCCTGCGT
CAGCGGCACCACGAACGCGGTCATGTGCGGGCTGGTTTCGTCACGGTGGATGCTGGCCGTCACGATGCGATCCGCCCCGT
ACTTGTCCGCCAGCCACTTGTGCGCCTTCTCGAAGAACGCCGCCTGCTGTTCTTGGCTGGCCGACTTCCACCATTCCGGG
CTGGCCGTCATGACGTACTCGACCGCCAACACAGCGTCCTTGCGCCGCTTCTCTGGCAGCAACTCGCGCAGTCGGCCCAT
CGCTTCATCGGTGCTGCTGGCCGCCCAGTGCTCGTTCTCTGGCGTCCTGCTGGCGTCAGCGTTGGGCGTCTCGCGCTCGC
GGTAGGCGTGCTTGAGACTGGCCGCCACGTTGCCCATTTTCGCCAGCTTCTTGCATCGCATGATCGCGTATGCCGCCATG
CCTGCCCCTCCCTTTTGGTGTCCAACCGGCTCGACGGGGGCAGCGCAAGGCGGTGCCTCCGGCGGGCCACTCAATGCTTG
AGTATACTCACTAGACTTTGCTTCGCAAAGTCGTGACCGCCTACGGCGGCTGCGGCGCCCTACGGGCTTGCTCTCCGGGC
TTCGCCCTGCGCGGTCGCTGCGCTCCCTTGCCAGCCCGTGGATATGTGGACGATGGCCGCGAGCGGCCACCGGCTGGCTC
GCTTCGCTCGGCCCGTGGACAACCCTGCTGGACAAGCTGATGGACAGGCTGCGCCTGCCCACGAGCTTGACCACAGGGAT
TGCCCACCGGCTACCCAGCCTTCGACCACATACCCACCGGCTCCAACTGCGCGGCCTGCGGCCTTGCCCCATCAATTTTT
TTAATTTTCTCTGGGGAAAAGCCTCCGGCCTGCGGCCTGCGCGCTTCGCTTGCCGGTTGGACACCAAGTGGAAGGCGGGT
CAAGGCTCGCGCAGCGACCGCGCAGCGGCTTGGCCTTGACGCGCCTGGAACGACCCAAGCCTATGCGAGTGGGGGCAGTC
GAAGGCGAAGCCCGCCCGCCTGCCCCCCGAGCCTCACGGCGGCGAGTGCGGGGGTTCCAAGGGGGCAGCGCCACCTTGGG
CAAGGCCGAAGGCCGCGCAGTCGATCAACAAGCCCCGGAGGGGCCACTTTTTGCCGGAGGGGGAGCCGCGCCGAAGGCGT
GGGGGAACCCCGCAGGGGTGCCCTTCTTTGGGCACCAAAGAACTAGATATAGGGCGAAATGCGAAAGACTTAAAAATCAA
CAACTTAAAAAAGGGGGGTACGCAACAGCTCATTGCGGCACCCCCCGCAATAGCTCATTGCGTAGGTTAAAGAAAATCTG
TAATTGACTGCCACTTTTACGCAACGCATAATTGTTGTCGCGCTGCCGAAAAGTTGCAGCTGATTGCGCATGGTGCCGCA
ACCGTGCGGCACCCTACCGCATGGAGATAAGCATGGCCACGCAGTCCAGAGAAATCGGCATTCAAGCCAAGAACAAGCCC
GGTCACTGGGTGCAAACGGAACGCAAAGCGCATGAGGCGTGGGCCGGGCTTATTGCGAGGAAACCCACGGCGGCAATGCT
GCTGCATCACCTCGTGGCGCAGATGGGCCACCAGAACGCCGTGGTGGTCAGCCAGAAGACACTTTCCAAGCTCATCGGAC
GTTCTTTGCGGACGGTCCAATACGCAGTCAAGGACTTGGTGGCCGAGCGCTGGATCTCCGTCGTGAAGCTCAACGGCCCC
GGCACCGTGTCGGCCTACGTGGTCAATGACCGCGTGGCGTGGGGCCAGCCCCGCGACCAGTTGCGCCTGTCGGTGTTCAG
TGCCGCCGTGGTGGTTGATCACGACGACCAGGACGAATCGCTGTTGGGGCATGGCGACCTGCGCCGCATCCCGACCCTGT
ATCCGGGCGAGCAGCAACTACCGACCGGCCCCGGCGAGGAGCCGCCCAGCCAGCCCGGCATTCCGGGCATGGAACCAGAC
CTGCCAGCCTTGACCGAAACGGAGGAATGGGAACGGCGCGGGCAGCAGCGCCTGCCGATGCCCGATGAGCCGTGTTTTCT
GGACGATGGCGAGCCGTTGGAGCCGCCGACACGGGTCACGCTGCCGCGCCGGTAGCACTTGGGTTGCGCAGCAACCCGTA
AGTGCGCTGTTCCAGACTATCGGCTGTAGCCGCCTCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGC
ATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCGTTTTTATCAGGCTCTGGGA
GGCAGAATAAATGATCATATCGTCAATTATTACCTCCACGGGGAGAGCCTGAGCAAACTGGCCTCAGGCATTTGAGAAGC
ACACGGTCACACTGCTTCCGGTAGTCAATAAACCGGTAAACCAGCAATAGACATAAGCGGCTATTTAACGACCCTGCCCT
GAACCGACGACCGGGTCGAATTTGCTTTCGAATTTCTGCCATTCATCCGCTTATTATCACTTATTCAGGCGTAGCACCAG
GCGTTTAAGGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATCGCAGTCGGCCTATTGGTTAAAA
AATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTG
CGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCG
ATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCAC
TATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCttgacaattaatcatcggctcgta
taatgtgtggaatttcacacaggaaacagtattcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcc
tggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaag
ctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgt
gcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccagg
agcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaac
cgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagcca
caacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggca
gcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctg
agcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgg
gatcactctcggcatggacgagctgtacaagTAATTTTTGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGG
GGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCT
GTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATG
AGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAAT
GAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCATGCATAAAAACTGTTGTAATTCATTAAGCATTCTG
CCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATA
TTTGCCCATGGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTTGACATAAGCCTGTTCGGTTCGTAAACTGTA
ATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTT
TCATGGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGA
TGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGT
TAGGTGGCTCAAGTATGGGCATCATTCGCACATGTAGGCTCGGCCCTGACCAAGTCAAATCCATGCGGGCTGCTCTTGAT
CTTTTCGGTCGTGAGTTCGGAGACGTAGCCACCTACTCCCAACATCAGCCGGACTCCGATTACCTCGGGAACTTGCTCCG
TAGTAAGACATTCATCGCGCTTGCTGCCTTCGACCAAGAAGCGGTTGTTGGCGCTCTCGCGGCTTACGTTCTGCCCAGGT
TTGAGCAGCCGCGTAGTGAGATCTATATCTATGATCTCGCAGTCTCCGGCGAGCACCGGAGGCAGGGCATTGCCACCGCG
CTCATCAATCTCCTCAAGCATGAGGCCAACGCGCTTGGTGCTTATGTGATCTACGTGCAAGCAGATTACGGTGACGATCC
CGCAGTGGCTCTCTATACAAAGTTGGGCATACGGGAAGAAGTGATGCACTTTGATATCGACCCAAGTACCGCCACCTAAC
AATTCGTTCAAGCCGAGATCGGCTTCCCGGCCGCGGAGTTGTTCGGTAAATTGTCACAACGCCGCCAGGTGGCACTTTTC
GGGGAAATGTGCGCGCCCGCGTTCCTGCTGGCGCTGGGCCTGTTTCTGGCGCTGGACTTCCCGCTGTTCCGTCAGCAGCT
TTTCGCCCACGGCCTTGATGATCGCGGCGGCCTTGGCCTGCATATCCCGATTCAACGGCCCCAGGGCGTCCAGAACGGGC
TTCAGGCGCTCCCGAAGGT

 

*Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart