pBI121- DsRed2 Plasmid

$182.00

  • Model: PVT3008
  • 49 Units in Stock
Ask a question


Add to Cart:

pBI121-DsRed2

PVT3008   2ug

 

pBI121-DsRed2 Information

Promoter: CaMV 35S

Replicon: ori

Plasmid classification: plant series, protein overexpression vector

Plasmid tagging: DsRed2

Prokaryotic resistance: Kan

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

Primers for 3'sequencing: primers designed based on sequences

Use: Plant expression

 

Search name

pBI121-DsRed2,Plasmid pBI121-DsRed2,pBI121-DsRed2 vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart