pBI121- EGFP


  • Model: PVT3004
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT3004  2ug

pBI121-EGFP Information

Promoter: CaMV 35S

Replicon: oriV

Terminator: NOS

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 13832bp

Plasmid label: N-10*His, N-EGFP, C-6*His

Prokaryotic resistance: Kan

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence

Use: Plant expression


pBI121-EGFP Description

pBI121-EGFP is transformed from pBI121 and EGFP label. It is a plant expression vector with Kanamycin kanamycin resistance and can be transformed into Escherichia coli DH5 alpha. A large number of replication and amplification are screened by Kan. The culture condition is LB, 37. The promoter of the pBI121-EGFP carrier is 35S, which can be mediated by Agrobacterium tumefaciens to express EGFP green fluorescent protein in plant cells, and the label has N-10*His, N-EGFP, C-6*His, and can be purified with nickel column. The enzyme sites of pBI121-EGFP include XhoI, NcoI, SalI, SpeI, XbaI, SmaI, BamHI, SacI, EcoRI, which can be selected according to needs.





pBI121-EGFP Sequence

LOCUS       Exported               13832 bp ds-DNA     circular SYN 13-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 3

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 13832)


  TITLE     Direct Submission

  JOURNAL   Exported Tuesday, September 13, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..13832

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             complement(145..516)



                     /product="oriT-recognizing protein"





     oriT            549..658

                     /note="incP origin of transfer"

     CDS             complement(1339..1989)



                     /product="tetracycline resistance regulatory protein"






     misc_feature    2454..2478

                     /note="RB T-DNA repeat"

                     /note="right border repeat from nopaline C58 T-DNA"

     promoter        2602..2781

                     /note="NOS promoter"

                     /note="nopaline synthase promoter"

     promoter        2634..2817

                     /function="NOS promoter"

                     /note="NOS promoter"

                     /note="nopaline synthase promoter"

     CDS             2838..3632


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"


                     /note="confers resistance to neomycin, kanamycin, and G418 







     terminator      4022..4274

                     /note="NOS terminator"

                     /note="nopaline synthase terminator and poly(A) signal"

     protein_bind    4823..4844

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     promoter        4859..4889

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    4897..4913

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     4921..4937

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     promoter        5461..5805

                     /note="CaMV 35S promoter"

                     /note="strong constitutive promoter from cauliflower mosaic


     CDS             5962..5991


                     /product="10xHis affinity tag"



     CDS             6013..6729


                     /product="enhanced GFP"


                     /note="mammalian codon-optimized"






     CDS             6748..6765


                     /product="6xHis affinity tag"



     terminator      6801..7053

                     /note="NOS terminator"

                     /note="nopaline synthase terminator and poly(A) signal"

     primer_bind     complement(7062..7078)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     misc_feature    7696..7720

                     /note="LB T-DNA repeat"

                     /note="left border repeat from nopaline C58 T-DNA"

     CDS             complement(9316..10464)


                     /product="trans-acting replication protein that binds to 

                     and activates oriV"









     CDS             complement(10763..11557)



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin"






     mobile_element  11749..12516

                     /mobile_element_type="insertion sequence:IS1"


                     /note="prokaryotic transposable element"

     rep_origin      13139..18


                     /note="incP origin of replication"


        1 tgagcgtcgc aaaggcgctc ggtcttgcct tgctcgtcgg tgatgtactt caccagctcc

       61 gcgaagtcgc tcttcttgat ggagcgcatg gggacgtgct tggcaatcac gcgcaccccc

      121 cggccgtttt agcggctaaa aaagtcatgg ctctgccctc gggcggacca cgcccatcat

      181 gaccttgcca agctcgtcct gcttctcttc gatcttcgcc agcagggcga ggatcgtggc

      241 atcaccgaac cgcgccgtgc gcgggtcgtc ggtgagccag agtttcagca ggccgcccag

      301 gcggcccagg tcgccattga tgcgggccag ctcgcggacg tgctcatagt ccacgacgcc

      361 cgtgattttg tagccctggc cgacggccag caggtaggcc gacaggctca tgccggccgc

      421 cgccgccttt tcctcaatcg ctcttcgttc gtctggaagg cagtacacct tgataggtgg

      481 gctgcccttc ctggttggct tggtttcatc agccatccgc ttgccctcat ctgttacgcc

      541 ggcggtagcc ggccagcctc gcagagcagg attcccgttg agcaccgcca ggtgcgaata

      601 agggacagtg aagaaggaac acccgctcgc gggtgggcct acttcaccta tcctgcccgg

      661 ctgacgccgt tggatacacc aaggaaagtc tacacgaacc ctttggcaaa atcctgtata

      721 tcgtgcgaaa aaggatggat ataccgaaaa aatcgctata atgaccccga agcagggtta

      781 tgcagcggaa aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg

      841 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt

      901 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag

      961 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt

     1021 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta

     1081 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt

     1141 cagtgagcga ggaagcggaa gagcgccaga aggccgccag agaggccgag cgcggccgtg

     1201 aggcttggac gctagggcag ggcatgaaaa agcccgtagc gggctgctac gggcgtctga

     1261 cgcggtggaa agggggaggg gatgttgtct acatggctct gctgtagtga gtgggttgcg

     1321 ctccggcagc ggtcctgatc aatcgtcacc ctttctcggt ccttcaacgt tcctgacaac

     1381 gagcctcctt ttcgccaatc catcgacaat caccgcgagt ccctgctcga acgctgcgtc

     1441 cggaccggct tcgtcgaagg cgtctatcgc ggcccgcaac agcggcgaga gcggagcctg

     1501 ttcaacggtg ccgccgcgct cgccggcatc gctgtcgccg gcctgctcct caagcacggc

     1561 cccaacagtg aagtagctga ttgtcatcag cgcattgacg gcgtccccgg ccgaaaaacc

     1621 cgcctcgcag aggaagcgaa gctgcgcgtc ggccgtttcc atctgcggtg cgcccggtcg

     1681 cgtgccggca tggatgcgcg cgccatcgcg gtaggcgagc agcgcctgcc tgaagctgcg

     1741 ggcattcccg atcagaaatg agcgccagtc gtcgtcggct ctcggcaccg aatgcgtatg

     1801 attctccgcc agcatggctt cggccagtgc gtcgagcagc gcccgcttgt tcctgaagtg

     1861 ccagtaaagc gccggctgct gaacccccaa ccgttccgcc agtttgcgtg tcgtcagacc

     1921 gtctacgccg acctcgttca acaggtccag ggcggcacgg atcactgtat tcggctgcaa

     1981 ctttgtcatg cttgacactt tatcactgat aaacataata tgtccaccaa cttatcagtg

     2041 ataaagaatc cgcgcgttca atcggaccag cggaggctgg tccggaggcc agacgtgaaa

     2101 cccaacatac ccctgatcgt aattctgagc actgtcgcgc tcgacgctgt cggcatcggc

     2161 ctgattatgc cggtgctgcc gggcctcctg cgcgatctgg ttcactcgaa cgacgtcacc

     2221 gcccactatg gcattctgct ggcgctgtat gcgttggtgc aatttgcctg cgcacctgtg

     2281 ctgggcgcgc tgtcggatcg tttcgggcgg cggccaatct tgctcgtctc gctggccggc

     2341 gccagatctg gggaaccctg tggttggcat gcacatacaa atggacgaac ggataaacct

     2401 tttcacgccc ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc

     2461 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga

     2521 tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc gggacaagcc

     2581 gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc cgcgggtttc

     2641 tggagtttaa tgagctaagc acatacgtca gaaaccatta ttgcgcgttc aaaagtcgcc

     2701 taaggtcact atcagctagc aaatatttct tgtcaaaaat gctccactga cgttccataa

     2761 attcccctcg gtatccaatt agagtctcat attcactctc aatccaaata atctgcaccg

     2821 gatctggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt

     2881 gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg

     2941 ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg

     3001 gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg

     3061 ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg

     3121 gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca

     3181 tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc

     3241 accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc

     3301 aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca

     3361 aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc tgcttgccga

     3421 atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg

     3481 cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg

     3541 aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg

     3601 ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga

     3661 ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag

     3721 gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct

     3781 catgctggag ttcttcgccc acgggatctc tgcggaacag gcggtcgaag gtgccgatat

     3841 cattacgaca gcaacggccg acaagcacaa cgccacgatc ctgagcgaca atatgatcgg

     3901 gcccggcgtc cacatcaacg gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg

     3961 cgatatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc

     4021 cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc

     4081 gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg

     4141 catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata

     4201 cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc

     4261 tatgttacta gatcgggcct cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg

     4321 gcggctctga gggtggtggc tctgagggtg gcggttctga gggtggcggc tctgagggag

     4381 gcggttccgg tggtggctct ggttccggtg attttgatta tgaaaagatg gcaaacgcta

     4441 ataagggggc tatgaccgaa aatgccgatg aaaacgcgct acagtctgac gctaaaggca

     4501 aacttgattc tgtcgctact gattacggtg ctgctatcga tggtttcatt ggtgacgttt

     4561 ccggccttgc taatggtaat ggtgctactg gtgattttgc tggctctaat tcccaaatgg

     4621 ctcaagtcgg tgacggtgat aattcacctt taatgaataa tttccgtcaa tatttacctt

     4681 ccctccctca atcggttgaa tgtcgccctt ttgtctttgg cccaatacgc aaaccgcctc

     4741 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag

     4801 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt

     4861 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca

     4921 caggaaacag ctatgaccat gattacgcca agcttgcatg cctgcaggtc cccagattag

     4981 ccttttcaat ttcagaaaga atgctaaccc acagatggtt agagaggctt acgcagcagg

     5041 tctcatcaag acgatctacc cgagcaataa tctccaggaa atcaaatacc ttcccaagaa

     5101 ggttaaagat gcagtcaaaa gattcaggac taactgcatc aagaacacag agaaagatat

     5161 atttctcaag atcagaagta ctattccagt atggacgatt caaggcttgc ttcacaaacc

     5221 aaggcaagta atagagattg gagtctctaa aaaggtagtt cccactgaat caaaggccat

     5281 ggagtcaaag attcaaatag aggacctaac agaactcgcc gtaaagactg gcgaacagtt

     5341 catacagagt ctcttacgac tcaatgacaa gaagaaaatc ttcgtcaaca tggtggagca

     5401 cgacacactt gtctactcca aaaatatcaa agatacagtc tcagaagacc aaagggcaat

     5461 tgagactttt caacaaaggg taatatccgg aaacctcctc ggattccatt gcccagctat

     5521 ctgtcacttt attgtgaaga tagtggaaaa ggaaggtggc tcctacaaat gccatcattg

     5581 cgataaagga aaggccatcg ttgaagatgc ctctgccgac agtggtccca aagatggacc

     5641 cccacccacg aggagcatcg tggaaaaaga agacgttcca accacgtctt caaagcaagt

     5701 ggattgatgt gatatctcca atgacgtaag ggatgacgca caatcccact atccttcgca

     5761 agacccttcc tctatataag gaagttcatt tcatttggag aggacctcga cctcaacaca

     5821 acatatacaa aacaaacgaa tctcaagcaa tcaagcattc tacttctatt gcagcaattt

     5881 aaatcatttc ttttaaagca aaagcaattt tctgaaaatt ttcaccattt acgaacgata

     5941 ctcgagatga cccgtggttc tcatcaccat caccatcacc atcaccatca cgccatggtc

     6001 gacgtactag tgatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg

     6061 gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc

     6121 gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg

     6181 ccctggccca ccctcgtgac caccttcacc tacggcgtgc agtgcttcag ccgctacccc

     6241 gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag

     6301 cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag

     6361 ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac

     6421 atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat catggccgac

     6481 aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc

     6541 gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg

     6601 cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc

     6661 gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactcacgg catggacgag

     6721 ctggacaagg gtctagaccc gggaatgcat caccatcacc atcacggatc ctgattgatc

     6781 gatagagctc gaatttcccc gatcgatcaa acatttggca ataaagtttc ttaagattga

     6841 atcctgttgc cgggcttgcg atgattatca tataatttct gttgaattac gttaaacatg

     6901 aaataattaa catgtaatgc atgacgttat ttatgatatg ggtttttatg attatagtcc

     6961 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac tacgataaat

     7021 tatcgcgcgc ggtgtcatct atgttactag atcgggaatt cactggccgt cgttttacaa

     7081 cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct

     7141 ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc

     7201 agcctgaatg gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg

     7261 ctttccccgt caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg

     7321 gcacctcgac cccaaaaaac ttgatttggg tgatggttca cgtagtgggc catcgccctg

     7381 atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt

     7441 ccaaactgga acaacactca accctatctc gggctattct tttgatttat aagggatttt

     7501 gccgatttcg gaaccaccat caaacaggat tttcgcctgc tggggcaaac cagcgtggac

     7561 cgcttgctgc aactctctca gggccaggcg gtgaagggca atcagctgtt gcccgtctca

     7621 ctggtgaaaa gaaaaaccac cccagtacat taaaaacgtc cgcaatgtgt tattaagttg

     7681 tctaagcgtc aatttgttta caccacaata tatcctgcca ccagccagcc aacagctccc

     7741 cgaccggcag ctcggcacaa aatcaccact cgatacaggc agcccatcag tccgggacgg

     7801 cgtcagcggg agagccgttg taaggcggca gactttgctc atgttaccga tgctattcgg

     7861 aagaacggca actaagctgc cgggtttgaa acacggatga tctcgcggag ggtagcatgt

     7921 tgattgtaac gatgacagag cgttgctgcc tgtgatcaaa tatcatctcc ctcgcagaga

     7981 tccgaattat cagccttctt attcatttct cgcttaaccg tgacaggctg tcgatcttga

     8041 gaactatgcc gacataatag gaaatcgctg gataaagccg ctgaggaagc tgagtggcgc

     8101 tatttcttta gaagtgaacg ttgacgatat caactcccct atccattgct caccgaatgg

     8161 tacaggtcgg ggacccgaag ttccgactgt cggcctgatg catccccggc tgatcgaccc

     8221 cagatctggg gctgagaaag cccagtaagg aaacaactgt aggttcgagt cgcgagatcc

     8281 cccggaacca aaggaagtag gttaaacccg ctccgatcag gccgagccac gccaggccga

     8341 gaacattggt tcctgtaggc atcgggattg gcggatcaaa cactaaagct actggaacga

     8401 gcagaagtcc tccggccgcc agttgccagg cggtaaaggt gagcagaggc acgggaggtt

     8461 gccacttgcg ggtcagcacg gttccgaacg ccatggaaac cgcccccgcc aggcccgctg

     8521 cgacgccgac aggatctagc gctgcgtttg gtgtcaacac caacagcgcc acgcccgcag

     8581 ttccgcaaat agcccccagg accgccatca atcgtatcgg gctacctagc agagcggcag

     8641 agatgaacac gaccatcagc ggctgcacag cgcctaccgt cgccgcgacc ccgcccggca

     8701 ggcggtagac cgaaataaac aacaagctcc agaatagcga aatattaagt gcgccgagga

     8761 tgaagatgcg catccaccag attcccgttg gaatctgtcg gacgatcatc acgagcaata

     8821 aacccgccgg caacgcccgc agcagcatac cggcgacccc tcggcctcgc tgttcgggct

     8881 ccacgaaaac gccggacaga tgcgccttgt gagcgtcctt ggggccgtcc tcctgtttga

     8941 agaccgacag cccaatgatc tcgccgtcga tgtaggcgcc gaatgccacg gcatctcgca

     9001 accgttcagc gaacgcctcc atgggctttt tctcctcgtg ctcgtaaacg gacccgaaca

     9061 tctctggagc tttcttcagg gccgacaatc ggatctcgcg gaaatcctgc acgtcggccg

     9121 ctccaagccg tcgaatctga gccttaatca caattgtcaa ttttaatcct ctgtttatcg

     9181 gcagttcgta gagcgcgccg tgcgtcccga gcgatactga gcgaagcaag tgcgtcgagc

     9241 agtgcccgct tgttcctgaa atgccagtaa agcgctggct gctgaacccc cagccggaac

     9301 tgaccccaca aggccctagc gtttgcaatg caccaggtca tcattgaccc aggcgtgttc

     9361 caccaggccg ctgcctcgca actcttcgca ggcttcgccg acctgctcgc gccacttctt

     9421 cacgcgggtg gaatccgatc cgcacatgag gcggaaggtt tccagcttga gcgggtacgg

     9481 ctcccggtgc gagctgaaat agtcgaacat ccgtcgggcc gtcggcgaca gcttgcggta

     9541 cttctcccat atgaatttcg tgtagtggtc gccagcaaac agcacgacga tttcctcgtc

     9601 gatcaggacc tggcaacggg acgttttctt gccacggtcc aggacgcgga agcggtgcag

     9661 cagcgacacc gattccaggt gcccaacgcg gtcggacgtg aagcccatcg ccgtcgcctg

     9721 taggcgcgac aggcattcct cggccttcgt gtaataccgg ccattgatcg accagcccag

     9781 gtcctggcaa agctcgtaga acgtgaaggt gatcggctcg ccgatagggg tgcgcttcgc

     9841 gtactccaac acctgctgcc acaccagttc gtcatcgtcg gcccgcagct cgacgccggt

     9901 gtaggtgatc ttcacgtcct tgttgacgtg gaaaatgacc ttgttttgca gcgcctcgcg

     9961 cgggattttc ttgttgcgcg tggtgaacag ggcagagcgg gccgtgtcgt ttggcatcgc

    10021 tcgcatcgtg tccggccacg gcgcaatatc gaacaaggaa agctgcattt ccttgatctg

    10081 ctgcttcgtg tgtttcagca acgcggcctg cttggcctcg ctgacctgtt ttgccaggtc

    10141 ctcgccggcg gtttttcgct tcttggtcgt catagttcct cgcgtgtcga tggtcatcga

    10201 cttcgccaaa cctgccgcct cctgttcgag acgacgcgaa cgctccacgg cggccgatgg

    10261 cgcgggcagg gcagggggag ccagttgcac gctgtcgcgc tcgatcttgg ccgtagcttg

    10321 ctggaccatc gagccgacgg actggaaggt ttcgcggggc gcacgcatga cggtgcggct

    10381 tgcgatggtt tcggcatcct cggcggaaaa ccccgcgtcg atcagttctt gcctgtatgc

    10441 cttccggtca aacgtccgat tcattcaccc tccttgcggg attgccccga ctcacgccgg

    10501 ggcaatgtgc ccttattcct gatttgaccc gcctggtgcc ttggtgtcca gataatccac

    10561 cttatcggca atgaagtcgg tcccgtagac cgtctggccg tccttctcgt acttggtatt

    10621 ccgaatcttg ccctgcacga ataccagcga ccccttgccc aaatacttgc cgtgggcctc

    10681 ggcctgagag ccaaaacact tgatgcggaa gaagtcggtg cgctcctgct tgtcgccggc

    10741 atcgttgcgc cacatctagg tactaaaaca attcatccag taaaatataa tattttattt

    10801 tctcccaatc aggcttgatc cccagtaagt caaaaaatag ctcgacatac tgttcttccc

    10861 cgatatcctc cctgatcgac cggacgcaga aggcaatgtc ataccacttg tccgccctgc

    10921 cgcttctccc aagatcaata aagccactta ctttgccatc tttcacaaag atgttgctgt

    10981 ctcccaggtc gccgtgggaa aagacaagtt cctcttcggg cttttccgtc tttaaaaaat

    11041 catacagctc gcgcggatct ttaaatggag tgtcttcttc ccagttttcg caatccacat

    11101 cggccagatc gttattcagt aagtaatcca attcggctaa gcggctgtct aagctattcg

    11161 tatagggaca atccgatatg tcgatggagt gaaagagcct gatgcactcc gcatacagct

    11221 cgataatctt ttcagggctt tgttcatctt catactcttc cgagcaaagg acgccatcgg

    11281 cctcactcat gagcagattg ctccagccat catgccgttc aaagtgcagg acctttggaa

    11341 caggcagctt tccttccagc catagcatca tgtccttttc ccgttccaca tcataggtgg

    11401 tccctttata ccggctgtcc gtcattttta aatataggtt ttcattttct cccaccagct

    11461 tatatacctt agcaggagac attccttccg tatcttttac gcagcggtat ttttcgatca

    11521 gttttttcaa ttccggtgat attctcattt tagccattta ttatttcctt cctcttttct

    11581 acagtattta aagatacccc aagaagctaa ttataacaag acgaactcca attcactgtt

    11641 ccttgcattc taaaacctta aataccagaa aacagctttt tcaaagttgt tttcaaagtt

    11701 ggcgtataac atagtatcga cggagccgat tttgaaacca caattatggg tgatgctgcc

    11761 aacttactga tttagtgtat gatggtgttt ttgaggtgct ccagtggctt ctgtgtctat

    11821 cagctgtccc tcctgttcag ctactgacgg ggtggtgcgt aacggcaaaa gcaccgccgg

    11881 acatcagcgc tatctctgct ctcactgccg taaaacatgg caactgcagt tcacttacac

    11941 cgcttctcaa cccggtacgc accagaaaat cattgatatg gccatgaatg gcgttggatg

    12001 ccgggcaaca gcccgcatta tgggcgttgg cctcaacacg attttacgtc acttaaaaaa

    12061 ctcaggccgc agtcggtaac ctcgcgcata cagccgggca gtgacgtcat cgtctgcgcg

    12121 gaaatggacg aacagtgggg ctatgtcggg gctaaatcgc gccagcgctg gctgttttac

    12181 gcgtatgaca gtctccggaa gacggttgtt gcgcacgtat tcggtgaacg cactatggcg

    12241 acgctggggc gtcttatgag cctgctgtca ccctttgacg tggtgatatg gatgacggat

    12301 ggctggccgc tgtatgaatc ccgcctgaag ggaaagctgc acgtaatcag caagcgatat

    12361 acgcagcgaa ttgagcggca taacctgaat ctgaggcagc acctggcacg gctgggacgg

    12421 aagtcgctgt cgttctcaaa atcggtggag ctgcatgaca aagtcatcgg gcattatctg

    12481 aacataaaac actatcaata agttggagtc attacccaat tatgatagaa tttacaagct

    12541 ataaggttat tgtcctgggt ttcaagcatt agtccatgca agtttttatg ctttgcccat

    12601 tctatagata tattgataag cgcgctgcct atgccttgcc ccctgaaatc cttacatacg

    12661 gcgatatctt ctatataaaa gatatattat cttatcagta ttgtcaatat attcaaggca

    12721 atctgcctcc tcatcctctt catcctcttc gtcttggtag ctttttaaat atggcgcttc

    12781 atagagtaat tctgtaaagg tccaattctc gttttcatac ctcggtataa tcttacctat

    12841 cacctcaaat ggttcgctgg gtttatcgca cccccgaaca cgagcacggc acccgcgacc

    12901 actatgccaa gaatgcccaa ggtaaaaatt gccggccccg ccatgaagtc cgtgaatgcc

    12961 ccgacggccg aagtgaaggg caggccgcca cccaggccgc cgccctcact gcccggcacc

    13021 tggtcgctga atgtcgatgc cagcacctgc ggcacgtcaa tgcttccggg cgtcgcgctc

    13081 gggctgatcg cccatcccgt tactgccccg atcccggcaa tggcaaggac tgccagcgct

    13141 gccatttttg gggtgaggcc gttcgcggcc gaggggcgca gcccctgggg ggatgggagg

    13201 cccgcgttag cgggccggga gggttcgaga agggggggca ccccccttcg gcgtgcgcgg

    13261 tcacgcgcac agggcgcagc cctggttaaa aacaaggttt ataaatattg gtttaaaagc

    13321 aggttaaaag acaggttagc ggtggccgaa aaacgggcgg aaacccttgc aaatgctgga

    13381 ttttctgcct gtggacagcc cctcaaatgt caataggtgc gcccctcatc tgtcagcact

    13441 ctgcccctca agtgtcaagg atcgcgcccc tcatctgtca gtagtcgcgc ccctcaagtg

    13501 tcaataccgc agggcactta tccccaggct tgtccacatc atctgtggga aactcgcgta

    13561 aaatcaggcg ttttcgccga tttgcgaggc tggccagctc cacgtcgccg gccgaaatcg

    13621 agcctgcccc tcatctgtca acgccgcgcc gggtgagtcg gcccctcaag tgtcaacgtc

    13681 cgcccctcat ctgtcagtga gggccaagtt ttccgcgagg tatccacaac gccggcggcc

    13741 gcggtgtctc gcacacggct tcgacggcgt ttctggcgcg tttgcagggc catagacggc

    13801 cgccagccca gcggcgaggg caaccagccc gg


Product is for research use only!


Search name

pBI121-EGFP,Plasmid pBI121-EGFP,pBI121-EGFP vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
