pBI121 new Plasmid


  • Model: PVT3003
  • 50 Units in Stock
Ask a question

Add to Cart:

pBI121 new

Search name

pBI121 new,Plasmid pBI121 new,pBI121 new vector


pBI121 Information

Promoter: CaMV 35S

Replicon: oriV

Terminator: NOS

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 14758bp

Prokaryotic resistance: Kan

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence

Use: Plant expression


pBI121 Description

PBI121 vector is a dual plant Agrobacterium expression vector, which can efficiently transfect plants. The carrier is derived from pB221 and Bin19 carriers. The carrier contains ori replicating elements from ColE1 sources, pROK1 elements derived from CaMV, II gene of Escherichia coli (Neomycin phosphotransferase II Gene, NptII), neomycin resistant gene (Neomycin resistant), sensitive gene glucosidase, and Agrobacterium tumefaciens The original part of carmine synthetase, etc. The pBI121 vector is the kanana resistant plasmid



pBI121 Sequence

LOCUS       Exported               14758 bp ds-DNA     circular SYN 13-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 14758)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 13, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..14758
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(145..516)
                     /product="oriT-recognizing protein"
     oriT            549..658
                     /note="incP origin of transfer"
     CDS             complement(1339..1989)
                     /product="tetracycline resistance regulatory protein"
     misc_feature    2454..2478
                     /note="RB T-DNA repeat"
                     /note="right border repeat from nopaline C58 T-DNA"
     promoter        2602..2781
                     /note="NOS promoter"
                     /note="nopaline synthase promoter"
     promoter        2634..2817
                     /function="NOS promoter"
                     /note="NOS promoter"
                     /note="nopaline synthase promoter"
     CDS             2838..3632
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     terminator      4022..4274
                     /note="NOS terminator"
                     /note="nopaline synthase terminator and poly(A) signal"
     protein_bind    4823..4844
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     promoter        4859..4889
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4897..4913
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4921..4937
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     promoter        5461..5806
                     /note="CaMV 35S promoter"
                     /note="strong constitutive promoter from cauliflower mosaic
     CDS             5845..7656
                     /gene="uidA (or gusA) from E. coli"
     terminator      7727..7979
                     /note="NOS terminator"
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
