pBI121(new Plasmid)


  • Model: PVT3003
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT3003     2ug


pBI121 Information

Promoter: CaMV 35S

Replicon: oriV

Terminator: NOS

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 14758bp

Prokaryotic resistance: Kan

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence

Use: Plant expression


pBI121 Description

PBI121 is a dual plant Agrobacterium expression vector, which can efficiently transfect plants. The carrier is derived from pB221 and Bin19 carriers. The carrier contains ori replicating elements from ColE1 sources, pROK1 elements derived from CaMV, II gene of Escherichia coli (Neomycin phosphotransferase II Gene, NptII), neomycin resistant gene (Neomycin resistant), sensitive gene glucosidase, and Agrobacterium tumefaciens The original part of carmine synthetase, etc. The pBI121 vector is the kanana resistant plasmid.


pBI121 Sequence

LOCUS       Exported               14758 bp ds-DNA     circular SYN 13-SEP-2016

DEFINITION  synthetic circular DNA

KEYWORDS    Untitled

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 14758)


  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..14758

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             complement(145..516)



                     /product="oriT-recognizing protein"





     oriT            549..658

                     /note="incP origin of transfer"

     CDS             complement(1339..1989)



                     /product="tetracycline resistance regulatory protein"






     misc_feature    2454..2478

                     /note="RB T-DNA repeat"

                     /note="right border repeat from nopaline C58 T-DNA"

     promoter        2602..2781

                     /note="NOS promoter"

                     /note="nopaline synthase promoter"

     promoter        2634..2817

                     /function="NOS promoter"

                     /note="NOS promoter"

                     /note="nopaline synthase promoter"

     CDS             2838..3632


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"


                     /note="confers resistance to neomycin, kanamycin, and G418 







     terminator      4022..4274

                     /note="NOS terminator"

                     /note="nopaline synthase terminator and poly(A) signal"

     protein_bind    4823..4844

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     promoter        4859..4889

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    4897..4913

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     4921..4937

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     promoter        5461..5806

                     /note="CaMV 35S promoter"

                     /note="strong constitutive promoter from cauliflower mosaic


     CDS             5845..7656


                     /gene="uidA (or gusA) from E. coli"














     terminator      7727..7979

                     /note="NOS terminator"

                     /note="nopaline synthase terminator and poly(A) signal"

     primer_bind     complement(7988..8004)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     misc_feature    8622..8646

                     /note="LB T-DNA repeat"

                     /note="left border repeat from nopaline C58 T-DNA"

     CDS             complement(10242..11390)


                     /product="trans-acting replication protein that binds to 

                     and activates oriV"









     CDS             complement(11689..12483)



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin"






     mobile_element  12675..13442

                     /mobile_element_type="insertion sequence:IS1"


                     /note="prokaryotic transposable element"

     rep_origin      14065..18


                     /note="incP origin of replication"


        1 tgagcgtcgc aaaggcgctc ggtcttgcct tgctcgtcgg tgatgtactt caccagctcc

       61 gcgaagtcgc tcttcttgat ggagcgcatg gggacgtgct tggcaatcac gcgcaccccc

      121 cggccgtttt agcggctaaa aaagtcatgg ctctgccctc gggcggacca cgcccatcat

      181 gaccttgcca agctcgtcct gcttctcttc gatcttcgcc agcagggcga ggatcgtggc

      241 atcaccgaac cgcgccgtgc gcgggtcgtc ggtgagccag agtttcagca ggccgcccag

      301 gcggcccagg tcgccattga tgcgggccag ctcgcggacg tgctcatagt ccacgacgcc

      361 cgtgattttg tagccctggc cgacggccag caggtaggcc gacaggctca tgccggccgc

      421 cgccgccttt tcctcaatcg ctcttcgttc gtctggaagg cagtacacct tgataggtgg

      481 gctgcccttc ctggttggct tggtttcatc agccatccgc ttgccctcat ctgttacgcc

      541 ggcggtagcc ggccagcctc gcagagcagg attcccgttg agcaccgcca ggtgcgaata

      601 agggacagtg aagaaggaac acccgctcgc gggtgggcct acttcaccta tcctgcccgg

      661 ctgacgccgt tggatacacc aaggaaagtc tacacgaacc ctttggcaaa atcctgtata

      721 tcgtgcgaaa aaggatggat ataccgaaaa aatcgctata atgaccccga agcagggtta

      781 tgcagcggaa aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg

      841 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt

      901 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag

      961 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt

     1021 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta

     1081 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt

     1141 cagtgagcga ggaagcggaa gagcgccaga aggccgccag agaggccgag cgcggccgtg

     1201 aggcttggac gctagggcag ggcatgaaaa agcccgtagc gggctgctac gggcgtctga

     1261 cgcggtggaa agggggaggg gatgttgtct acatggctct gctgtagtga gtgggttgcg

     1321 ctccggcagc ggtcctgatc aatcgtcacc ctttctcggt ccttcaacgt tcctgacaac

     1381 gagcctcctt ttcgccaatc catcgacaat caccgcgagt ccctgctcga acgctgcgtc

     1441 cggaccggct tcgtcgaagg cgtctatcgc ggcccgcaac agcggcgaga gcggagcctg

     1501 ttcaacggtg ccgccgcgct cgccggcatc gctgtcgccg gcctgctcct caagcacggc

     1561 cccaacagtg aagtagctga ttgtcatcag cgcattgacg gcgtccccgg ccgaaaaacc

     1621 cgcctcgcag aggaagcgaa gctgcgcgtc ggccgtttcc atctgcggtg cgcccggtcg

     1681 cgtgccggca tggatgcgcg cgccatcgcg gtaggcgagc agcgcctgcc tgaagctgcg

     1741 ggcattcccg atcagaaatg agcgccagtc gtcgtcggct ctcggcaccg aatgcgtatg

     1801 attctccgcc agcatggctt cggccagtgc gtcgagcagc gcccgcttgt tcctgaagtg

     1861 ccagtaaagc gccggctgct gaacccccaa ccgttccgcc agtttgcgtg tcgtcagacc

     1921 gtctacgccg acctcgttca acaggtccag ggcggcacgg atcactgtat tcggctgcaa

     1981 ctttgtcatg cttgacactt tatcactgat aaacataata tgtccaccaa cttatcagtg

     2041 ataaagaatc cgcgcgttca atcggaccag cggaggctgg tccggaggcc agacgtgaaa

     2101 cccaacatac ccctgatcgt aattctgagc actgtcgcgc tcgacgctgt cggcatcggc

     2161 ctgattatgc cggtgctgcc gggcctcctg cgcgatctgg ttcactcgaa cgacgtcacc

     2221 gcccactatg gcattctgct ggcgctgtat gcgttggtgc aatttgcctg cgcacctgtg

     2281 ctgggcgcgc tgtcggatcg tttcgggcgg cggccaatct tgctcgtctc gctggccggc

     2341 gccagatctg gggaaccctg tggttggcat gcacatacaa atggacgaac ggataaacct

     2401 tttcacgccc ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc

     2461 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga

     2521 tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc gggacaagcc

     2581 gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc cgcgggtttc

     2641 tggagtttaa tgagctaagc acatacgtca gaaaccatta ttgcgcgttc aaaagtcgcc

     2701 taaggtcact atcagctagc aaatatttct tgtcaaaaat gctccactga cgttccataa

     2761 attcccctcg gtatccaatt agagtctcat attcactctc aatccaaata atctgcaccg

     2821 gatctggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt

     2881 gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg

     2941 ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg

     3001 gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg

     3061 ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg

     3121 gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca

     3181 tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc

     3241 accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc

     3301 aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca

     3361 aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc tgcttgccga

     3421 atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg

     3481 cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg

     3541 aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg

     3601 ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga

     3661 ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag

     3721 gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct

     3781 catgctggag ttcttcgccc acgggatctc tgcggaacag gcggtcgaag gtgccgatat

     3841 cattacgaca gcaacggccg acaagcacaa cgccacgatc ctgagcgaca atatgatcgg

     3901 gcccggcgtc cacatcaacg gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg

     3961 cgatatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc

     4021 cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc

     4081 gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg

     4141 catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata

     4201 cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc

     4261 tatgttacta gatcgggcct cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg

     4321 gcggctctga gggtggtggc tctgagggtg gcggttctga gggtggcggc tctgagggag

     4381 gcggttccgg tggtggctct ggttccggtg attttgatta tgaaaagatg gcaaacgcta

     4441 ataagggggc tatgaccgaa aatgccgatg aaaacgcgct acagtctgac gctaaaggca

     4501 aacttgattc tgtcgctact gattacggtg ctgctatcga tggtttcatt ggtgacgttt

     4561 ccggccttgc taatggtaat ggtgctactg gtgattttgc tggctctaat tcccaaatgg

     4621 ctcaagtcgg tgacggtgat aattcacctt taatgaataa tttccgtcaa tatttacctt

     4681 ccctccctca atcggttgaa tgtcgccctt ttgtctttgg cccaatacgc aaaccgcctc

     4741 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag

     4801 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt

     4861 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca

     4921 caggaaacag ctatgaccat gattacgcca agcttgcatg cctgcaggtc cccagattag

     4981 ccttttcaat ttcagaaaga atgctaaccc acagatggtt agagaggctt acgcagcagg

     5041 tctcatcaag acgatctacc cgagcaataa tctccaggaa atcaaatacc ttcccaagaa

     5101 ggttaaagat gcagtcaaaa gattcaggac taactgcatc aagaacacag agaaagatat

     5161 atttctcaag atcagaagta ctattccagt atggacgatt caaggcttgc ttcacaaacc

     5221 aaggcaagta atagagattg gagtctctaa aaaggtagtt cccactgaat caaaggccat

     5281 ggagtcaaag attcaaatag aggacctaac agaactcgcc gtaaagactg gcgaacagtt

     5341 catacagagt ctcttacgac tcaatgacaa gaagaaaatc ttcgtcaaca tggtggagca

     5401 cgacacactt gtctactcca aaaatatcaa agatacagtc tcagaagacc aaagggcaat

     5461 tgagactttt caacaaaggg taatatccgg aaacctcctc ggattccatt gcccagctat

     5521 ctgtcacttt attgtgaaga tagtggaaaa ggaaggtggc tcctacaaat gccatcattg

     5581 cgataaagga aaggccatcg ttgaagatgc ctctgccgac agtggtccca aagatggacc

     5641 cccacccacg aggagcatcg tggaaaaaga agacgttcca accacgtctt caaagcaagt

     5701 ggattgatgt gatatctcca ctgacgtaag ggatgacgca caatcccact atccttcgca

     5761 agacccttcc tctatataag gaagttcatt tcatttggag agaacacggg ggactctaga

     5821 ggatccccgg gtggtcagtc ccttatgtta cgtcctgtag aaaccccaac ccgtgaaatc

     5881 aaaaaactcg acggcctgtg ggcattcagt ctggatcgcg aaaactgtgg aattgatcag

     5941 cgttggtggg aaagcgcgtt acaagaaagc cgggcaattg ctgtgccagg cagttttaac

     6001 gatcagttcg ccgatgcaga tattcgtaat tatgcgggca acgtctggta tcagcgcgaa

     6061 gtctttatac cgaaaggttg ggcaggccag cgtatcgtgc tgcgtttcga tgcggtcact

     6121 cattacggca aagtgtgggt caataatcag gaagtgatgg agcatcaggg cggctatacg

     6181 ccatttgaag ccgatgtcac gccgtatgtt attgccggga aaagtgtacg tatcaccgtt

     6241 tgtgtgaaca acgaactgaa ctggcagact atcccgccgg gaatggtgat taccgacgaa

     6301 aacggcaaga aaaagcagtc ttacttccat gatttcttta actatgccgg aatccatcgc

     6361 agcgtaatgc tctacaccac gccgaacacc tgggtggacg atatcaccgt ggtgacgcat

     6421 gtcgcgcaag actgtaacca cgcgtctgtt gactggcagg tggtggccaa tggtgatgtc

     6481 agcgttgaac tgcgtgatgc ggatcaacag gtggttgcaa ctggacaagg cactagcggg

     6541 actttgcaag tggtgaatcc gcacctctgg caaccgggtg aaggttatct ctatgaactg

     6601 tgcgtcacag ccaaaagcca gacagagtgt gatatctacc cgcttcgcgt cggcatccgg

     6661 tcagtggcag tgaagggcga acagttcctg attaaccaca aaccgttcta ctttactggc

     6721 tttggtcgtc atgaagatgc ggacttgcgt ggcaaaggat tcgataacgt gctgatggtg

     6781 cacgaccacg cattaatgga ctggattggg gccaactcct accgtacctc gcattaccct

     6841 tacgctgaag agatgctcga ctgggcagat gaacatggca tcgtggtgat tgatgaaact

     6901 gctgctgtcg gctttaacct ctctttaggc attggtttcg aagcgggcaa caagccgaaa

     6961 gaactgtaca gcgaagaggc agtcaacggg gaaactcagc aagcgcactt acaggcgatt

     7021 aaagagctga tagcgcgtga caaaaaccac ccaagcgtgg tgatgtggag tattgccaac

     7081 gaaccggata cccgtccgca aggtgcacgg gaatatttcg cgccactggc ggaagcaacg

     7141 cgtaaactcg acccgacgcg tccgatcacc tgcgtcaatg taatgttctg cgacgctcac

     7201 accgatacca tcagcgatct ctttgatgtg ctgtgcctga accgttatta cggatggtat

     7261 gtccaaagcg gcgatttgga aacggcagag aaggtactgg aaaaagaact tctggcctgg

     7321 caggagaaac tgcatcagcc gattatcatc accgaatacg gcgtggatac gttagccggg

     7381 ctgcactcaa tgtacaccga catgtggagt gaagagtatc agtgtgcatg gctggatatg

     7441 tatcaccgcg tctttgatcg cgtcagcgcc gtcgtcggtg aacaggtatg gaatttcgcc

     7501 gattttgcga cctcgcaagg catattgcgc gttggcggta acaagaaagg gatcttcact

     7561 cgcgaccgca aaccgaagtc ggcggctttt ctgctgcaaa aacgctggac tggcatgaac

     7621 ttcggtgaaa aaccgcagca gggaggcaaa caatgaatca acaactctcc tggcgcacca

     7681 tcgtcggcta cagcctcggg aattgctacc gagctcgaat ttccccgatc gttcaaacat

     7741 ttggcaataa agtttcttaa gattgaatcc tgttgccggt cttgcgatga ttatcatata

     7801 atttctgttg aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat

     7861 gagatgggtt tttatgatta gagtcccgca attatacatt taatacgcga tagaaaacaa

     7921 aatatagcgc gcaaactagg ataaattatc gcgcgcggtg tcatctatgt tactagatcg

     7981 ggaattcact ggccgtcgtt ttacaacgtc gtgactggga aaaccctggc gttacccaac

     8041 ttaatcgcct tgcagcacat ccccctttcg ccagctggcg taatagcgaa gaggcccgca

     8101 ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcgc ccgctccttt cgctttcttc

     8161 ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct

     8221 ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga tttgggtgat

     8281 ggttcacgta gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc

     8341 acgttcttta atagtggact cttgttccaa actggaacaa cactcaaccc tatctcgggc

     8401 tattcttttg atttataagg gattttgccg atttcggaac caccatcaaa caggattttc

     8461 gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga

     8521 agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccacccca gtacattaaa

     8581 aacgtccgca atgtgttatt aagttgtcta agcgtcaatt tgtttacacc acaatatatc

     8641 ctgccaccag ccagccaaca gctccccgac cggcagctcg gcacaaaatc accactcgat

     8701 acaggcagcc catcagtccg ggacggcgtc agcgggagag ccgttgtaag gcggcagact

     8761 ttgctcatgt taccgatgct attcggaaga acggcaacta agctgccggg tttgaaacac

     8821 ggatgatctc gcggagggta gcatgttgat tgtaacgatg acagagcgtt gctgcctgtg

     8881 atcaaatatc atctccctcg cagagatccg aattatcagc cttcttattc atttctcgct

     8941 taaccgtgac aggctgtcga tcttgagaac tatgccgaca taataggaaa tcgctggata

     9001 aagccgctga ggaagctgag tggcgctatt tctttagaag tgaacgttga cgatatcaac

     9061 tcccctatcc attgctcacc gaatggtaca ggtcggggac ccgaagttcc gactgtcggc

     9121 ctgatgcatc cccggctgat cgaccccaga tctggggctg agaaagccca gtaaggaaac

     9181 aactgtaggt tcgagtcgcg agatcccccg gaaccaaagg aagtaggtta aacccgctcc

     9241 gatcaggccg agccacgcca ggccgagaac attggttcct gtaggcatcg ggattggcgg

     9301 atcaaacact aaagctactg gaacgagcag aagtcctccg gccgccagtt gccaggcggt

     9361 aaaggtgagc agaggcacgg gaggttgcca cttgcgggtc agcacggttc cgaacgccat

     9421 ggaaaccgcc cccgccaggc ccgctgcgac gccgacagga tctagcgctg cgtttggtgt

     9481 caacaccaac agcgccacgc ccgcagttcc gcaaatagcc cccaggaccg ccatcaatcg

     9541 tatcgggcta cctagcagag cggcagagat gaacacgacc atcagcggct gcacagcgcc

     9601 taccgtcgcc gcgaccccgc ccggcaggcg gtagaccgaa ataaacaaca agctccagaa

     9661 tagcgaaata ttaagtgcgc cgaggatgaa gatgcgcatc caccagattc ccgttggaat

     9721 ctgtcggacg atcatcacga gcaataaacc cgccggcaac gcccgcagca gcataccggc

     9781 gacccctcgg cctcgctgtt cgggctccac gaaaacgccg gacagatgcg ccttgtgagc

     9841 gtccttgggg ccgtcctcct gtttgaagac cgacagccca atgatctcgc cgtcgatgta

     9901 ggcgccgaat gccacggcat ctcgcaaccg ttcagcgaac gcctccatgg gctttttctc

     9961 ctcgtgctcg taaacggacc cgaacatctc tggagctttc ttcagggccg acaatcggat

    10021 ctcgcggaaa tcctgcacgt cggccgctcc aagccgtcga atctgagcct taatcacaat

    10081 tgtcaatttt aatcctctgt ttatcggcag ttcgtagagc gcgccgtgcg tcccgagcga

    10141 tactgagcga agcaagtgcg tcgagcagtg cccgcttgtt cctgaaatgc cagtaaagcg

    10201 ctggctgctg aacccccagc cggaactgac cccacaaggc cctagcgttt gcaatgcacc

    10261 aggtcatcat tgacccaggc gtgttccacc aggccgctgc ctcgcaactc ttcgcaggct

    10321 tcgccgacct gctcgcgcca cttcttcacg cgggtggaat ccgatccgca catgaggcgg

    10381 aaggtttcca gcttgagcgg gtacggctcc cggtgcgagc tgaaatagtc gaacatccgt

    10441 cgggccgtcg gcgacagctt gcggtacttc tcccatatga atttcgtgta gtggtcgcca

    10501 gcaaacagca cgacgatttc ctcgtcgatc aggacctggc aacgggacgt tttcttgcca

    10561 cggtccagga cgcggaagcg gtgcagcagc gacaccgatt ccaggtgccc aacgcggtcg

    10621 gacgtgaagc ccatcgccgt cgcctgtagg cgcgacaggc attcctcggc cttcgtgtaa

    10681 taccggccat tgatcgacca gcccaggtcc tggcaaagct cgtagaacgt gaaggtgatc

    10741 ggctcgccga taggggtgcg cttcgcgtac tccaacacct gctgccacac cagttcgtca

    10801 tcgtcggccc gcagctcgac gccggtgtag gtgatcttca cgtccttgtt gacgtggaaa

    10861 atgaccttgt tttgcagcgc ctcgcgcggg attttcttgt tgcgcgtggt gaacagggca

    10921 gagcgggccg tgtcgtttgg catcgctcgc atcgtgtccg gccacggcgc aatatcgaac

    10981 aaggaaagct gcatttcctt gatctgctgc ttcgtgtgtt tcagcaacgc ggcctgcttg

    11041 gcctcgctga cctgttttgc caggtcctcg ccggcggttt ttcgcttctt ggtcgtcata

    11101 gttcctcgcg tgtcgatggt catcgacttc gccaaacctg ccgcctcctg ttcgagacga

    11161 cgcgaacgct ccacggcggc cgatggcgcg ggcagggcag ggggagccag ttgcacgctg

    11221 tcgcgctcga tcttggccgt agcttgctgg accatcgagc cgacggactg gaaggtttcg

    11281 cggggcgcac gcatgacggt gcggcttgcg atggtttcgg catcctcggc ggaaaacccc

    11341 gcgtcgatca gttcttgcct gtatgccttc cggtcaaacg tccgattcat tcaccctcct

    11401 tgcgggattg ccccgactca cgccggggca atgtgccctt attcctgatt tgacccgcct

    11461 ggtgccttgg tgtccagata atccacctta tcggcaatga agtcggtccc gtagaccgtc

    11521 tggccgtcct tctcgtactt ggtattccga atcttgccct gcacgaatac cagcgacccc

    11581 ttgcccaaat acttgccgtg ggcctcggcc tgagagccaa aacacttgat gcggaagaag

    11641 tcggtgcgct cctgcttgtc gccggcatcg ttgcgccaca tctaggtact aaaacaattc

    11701 atccagtaaa atataatatt ttattttctc ccaatcaggc ttgatcccca gtaagtcaaa

    11761 aaatagctcg acatactgtt cttccccgat atcctccctg atcgaccgga cgcagaaggc

    11821 aatgtcatac cacttgtccg ccctgccgct tctcccaaga tcaataaagc cacttacttt

    11881 gccatctttc acaaagatgt tgctgtctcc caggtcgccg tgggaaaaga caagttcctc

    11941 ttcgggcttt tccgtcttta aaaaatcata cagctcgcgc ggatctttaa atggagtgtc

    12001 ttcttcccag ttttcgcaat ccacatcggc cagatcgtta ttcagtaagt aatccaattc

    12061 ggctaagcgg ctgtctaagc tattcgtata gggacaatcc gatatgtcga tggagtgaaa

    12121 gagcctgatg cactccgcat acagctcgat aatcttttca gggctttgtt catcttcata

    12181 ctcttccgag caaaggacgc catcggcctc actcatgagc agattgctcc agccatcatg

    12241 ccgttcaaag tgcaggacct ttggaacagg cagctttcct tccagccata gcatcatgtc

    12301 cttttcccgt tccacatcat aggtggtccc tttataccgg ctgtccgtca tttttaaata

    12361 taggttttca ttttctccca ccagcttata taccttagca ggagacattc cttccgtatc

    12421 ttttacgcag cggtattttt cgatcagttt tttcaattcc ggtgatattc tcattttagc

    12481 catttattat ttccttcctc ttttctacag tatttaaaga taccccaaga agctaattat

    12541 aacaagacga actccaattc actgttcctt gcattctaaa accttaaata ccagaaaaca

    12601 gctttttcaa agttgttttc aaagttggcg tataacatag tatcgacgga gccgattttg

    12661 aaaccacaat tatgggtgat gctgccaact tactgattta gtgtatgatg gtgtttttga

    12721 ggtgctccag tggcttctgt gtctatcagc tgtccctcct gttcagctac tgacggggtg

    12781 gtgcgtaacg gcaaaagcac cgccggacat cagcgctatc tctgctctca ctgccgtaaa

    12841 acatggcaac tgcagttcac ttacaccgct tctcaacccg gtacgcacca gaaaatcatt

    12901 gatatggcca tgaatggcgt tggatgccgg gcaacagccc gcattatggg cgttggcctc

    12961 aacacgattt tacgtcactt aaaaaactca ggccgcagtc ggtaacctcg cgcatacagc

    13021 cgggcagtga cgtcatcgtc tgcgcggaaa tggacgaaca gtggggctat gtcggggcta

    13081 aatcgcgcca gcgctggctg ttttacgcgt atgacagtct ccggaagacg gttgttgcgc

    13141 acgtattcgg tgaacgcact atggcgacgc tggggcgtct tatgagcctg ctgtcaccct

    13201 ttgacgtggt gatatggatg acggatggct ggccgctgta tgaatcccgc ctgaagggaa

    13261 agctgcacgt aatcagcaag cgatatacgc agcgaattga gcggcataac ctgaatctga

    13321 ggcagcacct ggcacggctg ggacggaagt cgctgtcgtt ctcaaaatcg gtggagctgc

    13381 atgacaaagt catcgggcat tatctgaaca taaaacacta tcaataagtt ggagtcatta

    13441 cccaattatg atagaattta caagctataa ggttattgtc ctgggtttca agcattagtc

    13501 catgcaagtt tttatgcttt gcccattcta tagatatatt gataagcgcg ctgcctatgc

    13561 cttgccccct gaaatcctta catacggcga tatcttctat ataaaagata tattatctta

    13621 tcagtattgt caatatattc aaggcaatct gcctcctcat cctcttcatc ctcttcgtct

    13681 tggtagcttt ttaaatatgg cgcttcatag agtaattctg taaaggtcca attctcgttt

    13741 tcatacctcg gtataatctt acctatcacc tcaaatggtt cgctgggttt atcgcacccc

    13801 cgaacacgag cacggcaccc gcgaccacta tgccaagaat gcccaaggta aaaattgccg

    13861 gccccgccat gaagtccgtg aatgccccga cggccgaagt gaagggcagg ccgccaccca

    13921 ggccgccgcc ctcactgccc ggcacctggt cgctgaatgt cgatgccagc acctgcggca

    13981 cgtcaatgct tccgggcgtc gcgctcgggc tgatcgccca tcccgttact gccccgatcc

    14041 cggcaatggc aaggactgcc agcgctgcca tttttggggt gaggccgttc gcggccgagg

    14101 ggcgcagccc ctggggggat gggaggcccg cgttagcggg ccgggagggt tcgagaaggg

    14161 ggggcacccc ccttcggcgt gcgcggtcac gcgcacaggg cgcagccctg gttaaaaaca

    14221 aggtttataa atattggttt aaaagcaggt taaaagacag gttagcggtg gccgaaaaac

    14281 gggcggaaac ccttgcaaat gctggatttt ctgcctgtgg acagcccctc aaatgtcaat

    14341 aggtgcgccc ctcatctgtc agcactctgc ccctcaagtg tcaaggatcg cgcccctcat

    14401 ctgtcagtag tcgcgcccct caagtgtcaa taccgcaggg cacttatccc caggcttgtc

    14461 cacatcatct gtgggaaact cgcgtaaaat caggcgtttt cgccgatttg cgaggctggc

    14521 cagctccacg tcgccggccg aaatcgagcc tgcccctcat ctgtcaacgc cgcgccgggt

    14581 gagtcggccc ctcaagtgtc aacgtccgcc cctcatctgt cagtgagggc caagttttcc

    14641 gcgaggtatc cacaacgccg gcggccgcgg tgtctcgcac acggcttcga cggcgtttct

    14701 ggcgcgtttg cagggccata gacggccgcc agcccagcgg cgagggcaac cagcccgg


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
