pBI221- EGFP Plasmid


  • Model: PVT3007
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pBI221-EGFP,Plasmid pBI221-EGFP,pBI221-EGFP vector


pBI221-EGFP Information

Promoter: CaMV 35S, Lac

Replicon: ori

Terminator: NOS

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 4530bp

Prokaryotic resistance: Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence

Expression: Plant
Use: Plant expression


pBI221-EGFP Description

Most studies related to determining the expression profile of genes and specific promoters used histochemical localization of the reporter gene, gusA. While the histochemical method for visualizing gusA expression suffers from several limitations in the determination of gene expression and location, especially in the tissues with high background acitivty. To solve this problem, a transient expession vector pBI221-RFP/GFP, was constructed using GFP and RFP as double fluorescent marker genes. This vector used CaMV 35S promoter to drive GFP and determine the transforming efficiency. It analyzed expression profile of the target gene and promoter through the RFP activities of the tranformed tissues. Through the specific promoter AGPL1 from watermelon and E8 promoter from tomato, it is resistible to use this vector to study the expression patterns of promoters. Results indicated that the pBI221-RFP/GFP is a very efficient transient expression vector that can be verify the functions of the genes and promoters.



pBI221-EGFP Sequence

LOCUS       Exported                4530 bp ds-DNA     circular SYN 13-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4530)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 13, 2016 from SnapGene Viewer 3.2.1
FEATURES             Location/Qualifiers
     source          1..4530
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        512..857
                     /note="CaMV 35S promoter"
                     /note="strong constitutive promoter from cauliflower mosaic
     CDS             903..1622
                     /product="enhanced GFP"
                     /note="mammalian codon-optimized"
     terminator      1641..1893
                     /note="NOS terminator"
                     /note="nopaline synthase terminator and poly(A) signal"
     primer_bind     complement(1902..1918)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar 
     promoter        2392..2496
                     /note="AmpR promoter"
     CDS             2497..3357
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      3528..4116
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     protein_bind    4404..4425
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     promoter        4440..4470
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4478..4494
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4502..4518
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
        1 aagcttgcat gcctgcaggt ccccagatta gccttttcaa tttcagaaag aatgctaacc
       61 cacagatggt tagagaggct tacgcagcag gtctcatcaa gacgatctac ccgagcaata
      121 atctccagga aatcaaatac cttcccaaga aggttaaaga tgcagtcaaa agattcagga
      181 ctaactgcat caagaacaca gagaaagata tatttctcaa gatcagaagt actattccag
      241 tatggacgat tcaaggcttg cttcacaaac caaggcaagt aatagagatt ggagtctcta
      301 aaaaggtagt tcccactgaa tcaaaggcca tggagtcaaa gattcaaata gaggacctaa
      361 cagaactcgc cgtaaagact ggcgaacagt tcatacagag tctcttacga ctcaatgaca
      421 agaagaaaat cttcgtcaac atggtggagc acgacacact tgtctactcc aaaaatatca
      481 aagatacagt ctcagaagac caaagggcaa ttgagacttt tcaacaaagg gtaatatccg
      541 gaaacctcct cggattccat tgcccagcta tctgtcactt tattgtgaag atagtggaaa
      601 aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg aaaggccatc gttgaagatg
      661 cctctgccga cagtggtccc aaagatggac ccccacccac gaggagcatc gtggaaaaag
      721 aagacgttcc aaccacgtct tcaaagcaag tggattgatg tgatatctcc actgacgtaa
      781 gggatgacgc acaatcccac tatccttcgc aagacccttc ctctatataa ggaagttcat
      841 ttcatttgga gagaacacgg gggactctag aggatccgaa ttcgagctcc gtcgacaagc
      901 ttatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg
      961 acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct
     1021 acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca
     1081 ccctcgtgac caccttcacc tacggcgtgc agtgcttcag ccgctacccc gaccacatga
     1141 agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct
     1201 tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc
     1261 tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc
     1321 acaagctgga gtacaactac aacagccaca acgtctatat catggccgac aagcagaaga
     1381 acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg
     1441 ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
