
  • Model: PVT3007
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT3007      2ug


pBI221-EGFP Information

Promoter: CaMV 35S, Lac

Replicon: ori

Terminator: NOS

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 4530bp

Prokaryotic resistance: Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence

Expression: Plant
Use: Plant expression


pBI221-EGFP Description

Most studies related to determining the expression profile of genes and specific promoters used histochemical localization of the reporter gene, gusA. While the histochemical method for visualizing gusA expression suffers from several limitations in the determination of gene expression and location, especially in the tissues with high background acitivty. To solve this problem, a transient expession vector pBI221-RFP/GFP, was constructed using GFP and RFP as double fluorescent marker genes. This vector used CaMV 35S promoter to drive GFP and determine the transforming efficiency. It analyzed expression profile of the target gene and promoter through the RFP activities of the tranformed tissues. Through the specific promoter AGPL1 from watermelon and E8 promoter from tomato, it is resistible to use this vector to study the expression patterns of promoters. Results indicated that the pBI221-RFP/GFP is a very efficient transient expression vector that can be verify the functions of the genes and promoters.



pBI221-EGFP Sequence

LOCUS       Exported                4530 bp ds-DNA     circular SYN 13-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 2

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4530)


  TITLE     Direct Submission

  JOURNAL   Exported Tuesday, September 13, 2016 from SnapGene Viewer 3.2.1

FEATURES             Location/Qualifiers

     source          1..4530

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        512..857

                     /note="CaMV 35S promoter"

                     /note="strong constitutive promoter from cauliflower mosaic


     CDS             903..1622


                     /product="enhanced GFP"


                     /note="mammalian codon-optimized"






     terminator      1641..1893

                     /note="NOS terminator"

                     /note="nopaline synthase terminator and poly(A) signal"

     primer_bind     complement(1902..1918)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     promoter        2392..2496


                     /note="AmpR promoter"

     CDS             2497..3357





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      3528..4116



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     protein_bind    4404..4425

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     promoter        4440..4470

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    4478..4494

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     4502..4518

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 



        1 aagcttgcat gcctgcaggt ccccagatta gccttttcaa tttcagaaag aatgctaacc

       61 cacagatggt tagagaggct tacgcagcag gtctcatcaa gacgatctac ccgagcaata

      121 atctccagga aatcaaatac cttcccaaga aggttaaaga tgcagtcaaa agattcagga

      181 ctaactgcat caagaacaca gagaaagata tatttctcaa gatcagaagt actattccag

      241 tatggacgat tcaaggcttg cttcacaaac caaggcaagt aatagagatt ggagtctcta

      301 aaaaggtagt tcccactgaa tcaaaggcca tggagtcaaa gattcaaata gaggacctaa

      361 cagaactcgc cgtaaagact ggcgaacagt tcatacagag tctcttacga ctcaatgaca

      421 agaagaaaat cttcgtcaac atggtggagc acgacacact tgtctactcc aaaaatatca

      481 aagatacagt ctcagaagac caaagggcaa ttgagacttt tcaacaaagg gtaatatccg

      541 gaaacctcct cggattccat tgcccagcta tctgtcactt tattgtgaag atagtggaaa

      601 aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg aaaggccatc gttgaagatg

      661 cctctgccga cagtggtccc aaagatggac ccccacccac gaggagcatc gtggaaaaag

      721 aagacgttcc aaccacgtct tcaaagcaag tggattgatg tgatatctcc actgacgtaa

      781 gggatgacgc acaatcccac tatccttcgc aagacccttc ctctatataa ggaagttcat

      841 ttcatttgga gagaacacgg gggactctag aggatccgaa ttcgagctcc gtcgacaagc

      901 ttatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg

      961 acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct

     1021 acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca

     1081 ccctcgtgac caccttcacc tacggcgtgc agtgcttcag ccgctacccc gaccacatga

     1141 agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct

     1201 tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc

     1261 tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc

     1321 acaagctgga gtacaactac aacagccaca acgtctatat catggccgac aagcagaaga

     1381 acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg

     1441 ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc

     1501 actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg

     1561 tcctgctgga gttcgtgacc gccgccggga tcactcacgg catggacgag ctgtacaagt

     1621 aaagcggccc gaatttcccc gatcgttcaa acatttggca ataaagtttc ttaagattga

     1681 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg

     1741 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc

     1801 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat

     1861 tatcgcgcgc ggtgtcatct atgttactag atcgggaatt cactggccgt cgttttacaa

     1921 cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct

     1981 ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc

     2041 agcctgaatg gcgaatggcg cctgatgcgg tattttctcc ttacgcatct gtgcggtatt

     2101 tcacaccgca tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag

     2161 ccccgacacc cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc

     2221 gcttacagac aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca

     2281 tcaccgaaac gcgcgagacg aaagggcctc gtgatacgcc tatttttata ggttaatgtc

     2341 atgataataa tggtttctta gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc

     2401 cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc

     2461 tgataaatgc ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc

     2521 gcccttattc ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg

     2581 gtgaaagtaa aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat

     2641 ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc

     2701 acttttaaag ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa

     2761 ctcggtcgcc gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa

     2821 aagcatctta cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt

     2881 gataacactg cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct

     2941 tttttgcaca acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat

     3001 gaagccatac caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg

     3061 cgcaaactat taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg

     3121 atggaggcgg ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt

     3181 attgctgata aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg

     3241 ccagatggta agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg

     3301 gatgaacgaa atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg

     3361 tcagaccaag tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa

     3421 aggatctagg tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt

     3481 tcgttccact gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt

     3541 tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt

     3601 ttgccggatc aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag

     3661 ataccaaata ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta

     3721 gcaccgccta catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat

     3781 aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg

     3841 ggctgaacgg ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg

     3901 agatacctac agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac

     3961 aggtatccgg taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga

     4021 aacgcctggt atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt

     4081 ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta

     4141 cggttcctgg ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat

     4201 tctgtggata accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg

     4261 accgagcgca gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct

     4321 ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa

     4381 gcgggcagtg agcgcaacgc aattaatgtg agttagctca ctcattaggc accccaggct

     4441 ttacacttta tgcttccggc tcgtatgttg tgtggaattg tgagcggata acaatttcac

     4501 acaggaaaca gctatgacca tgattacgcc



Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
