pBiFC- VC155


  • Model: PVT10840
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10840
Packing 2ug

pBiFC-VC155 Information

Promoter: CMV

Replicon: PUC

Terminator: SV40 poly (a) signal

Plasmid classification: mammalian cells, bimolecular fluorescent complementary vector

Plasmid size: 4088 BP

Prokaryotic resistance: amp

Clone strain: dh5a

Culture conditions: 37 degrees

Expression host: mammalian cells

Induction mode: transient expression without induction

5 'sequencing primer: cmv-f: cgcaaaatgggcgtgtgtgggtgggtg

3 'sequencing primer: sv40-polya-r: gaaatttgatgctattgc

Plasmid host: mammalian cells

Plasmid usage: signal report

Fragment type:

Fragment species:

Prokaryotic resistance: amp


pBiFC-VC155 Description

PBiFC-VC155 by pCMV-HA vector in KpnI and inserted at the NotI locus of VC155 gene, the plasmid is high copy plasmid, VC155 gene derived from Vitoria victoria. Visualization of Aequorea Aequorea ternary complexes in living cells by using a BiFC-based FRET analysis.
Nature Protocols, 3:1693-1702 (2008).


pBiFC-VC155 Sequence

LOCUS       Exported                4088 bp ds-DNA     circular SYN 29-JUN-2016

DEFINITION  synthetic circular DNA




SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4088)


  TITLE     Direct Submission

  JOURNAL   Exported Sunday, September 4, 2016 from SnapGene Viewer 3.1.4


FEATURES             Location/Qualifiers

     source          1..4088

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             4..30


                     /product="HA (human influenza hemagglutinin) epitope tag"



     misc_feature    82..384


     polyA_signal    399..533

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     primer_bind     complement(644..660)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    668..684

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(692..722)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    737..758

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     rep_origin      complement(1046..1634)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(1805..2665)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(2666..2770)


                     /note="AmpR promoter"

     primer_bind     3244..3260

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     enhancer        3287..3590

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        3591..3794

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     intron          3932..4028

                     /note="SV40 intron"

                     /note="modified SV40 intron with splice donor and acceptor 



        1 atgtacccat acgatgttcc agattacgct cttatggcca tggaggcccg aattcggtcg

       61 accgagatct ctcgaggtac ccgtccggcg tgcaaaatcc cgaacgacct gaaacagaaa

      121 gtcatgaacc acgacaagca gaagaacggc atcaaggcca acttcaagat ccgccacaac

      181 atcgaggacg gcggcgtgca gctcgccgac cactaccagc agaacacccc catcggcgac

      241 ggccccgtgc tgctgcccga caaccactac ctgagctacc agtccaaact gagcaaagac

      301 cccaacgaga agcgcgatca catggtcctg ctggagttcg tgaccgccgc cgggatcact

      361 ctcggcatgg acgagctgta caagtaagcg gccgcgggga tccagacatg ataagataca

      421 ttgatgagtt tggacaaacc acaactagaa tgcagtgaaa aaaatgcttt atttgtgaaa

      481 tttgtgatgc tattgcttta tttgtaacca ttataagctg caataaacaa gttaacaaca

      541 acaattgcat tcattttatg tttcaggttc agggggaggt gtgggaggtt ttttcggatc

      601 ctctagagtc gatctgcagg catgctagct tggcgtaatc atggtcatag ctgtttcctg

      661 tgtgaaattg ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta

      721 aagcctgggg tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg

      781 ctttccagtc gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga

      841 gaggcggttt gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg

      901 tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag

      961 aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc

     1021 gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca

     1081 aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt

     1141 ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc

     1201 tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc

     1261 tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc

     1321 ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact

     1381 tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg

     1441 ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta

     1501 tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca

     1561 aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa

     1621 aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg

     1681 aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc

     1741 ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg

     1801 acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat

     1861 ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg

     1921 gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa

     1981 taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca

     2041 tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc

     2101 gcaacgttgt tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt

     2161 cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa

     2221 aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat

     2281 cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct

     2341 tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga

     2401 gttgctcttg cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag

     2461 tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga

     2521 gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca

     2581 ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg

     2641 cgacacggaa atgttgaata ctcatactct tcctttttca atattattga agcatttatc

     2701 agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag

     2761 gggttccgcg cacatttccc cgaaaagtgc cacctgacgt ctaagaaacc attattatca

     2821 tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtctcgcg cgtttcggtg

     2881 atgacggtga aaacctctga cacatgcagc tcccggagac ggtcacagct tgtctgtaag

     2941 cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg

     3001 gctggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat atgcggtgtg

     3061 aaataccgca cagatgcgta aggagaaaat accgcatcag gcgccattcg ccattcaggc

     3121 tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc gctattacgc cagctggcga

     3181 aagggggatg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc cagtcacgac

     3241 gttgtaaaac gacggccagt gagttcgagc ttgcatgcct gcaggtcgtt acataactta

     3301 cggtaaatgg cccgcctggc tgaccgccca acgacccccg cccattgacg tcaataatga

     3361 cgtatgttcc catagtaacg ccaataggga ctttccattg acgtcaatgg gtggagtatt

     3421 tacggtaaac tgcccacttg gcagtacatc aagtgtatca tatgccaagt acgcccccta

     3481 ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc ccagtacatg accttatggg

     3541 actttcctac ttggcagtac atctacgtat tagtcatcgc tattaccatg gtgatgcggt

     3601 tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt ccaagtctcc

     3661 accccattga cgtcaatggg agtttgtttt ggcaccaaaa tcaacgggac tttccaaaat

     3721 gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag gcgtgtacgg tgggaggtct

     3781 atataagcag agctcgttta gtgaaccgtc agatcgcctg gagacgccat ccacgctgtt

     3841 ttgacctcca tagaagacac cgggaccgat ccagcctccg gactctagag gatccggtac

     3901 tagaggaact gaaaaaccag aaagttaact ggtaagttta gtctttttgt cttttatttc

     3961 aggtcccgga tccggtggtg gtgcaaatca aagaactgct cctcagtgga tgttgccttt

     4021 acttctaggc ctgtacggaa gtgttacttc tgctctaaaa gctgcggaat tgtacccgcg

     4081 ggcccacc


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
