pBin19

$236.00

  • Model: PVT11459
  • 49 Units in Stock
Ask a question


Add to Cart:

pBin19


Catalog No.PVT11459
Packing 2ug


pBin19 Alternative name
pBin19pBin19 vector, pBin19 plasmid, pBin19 map, pBin19 sequence

 

pBin19 Information

Promoter -
Replicon -
Terminator -
Resistance Kan
Screening  G418
Strain   Stbl3
Culture conditions LB/37℃
Size 11777bp
 

pBin19 Sequence

CCGGGCTGGTTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCAGAAACGCCGTCGAAGCCGTGT
GCGAGACACCGCGGCCGCCGGCGTTGTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGACGTTGA
CACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGGGCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGC
CAGCCTCGCAAATCGGCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGCCTGGGGATAAGTGCC
CTGCGGTATTGACACTTGAGGGGCGCGACTACTGACAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGA
CAGATGAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCCAGCATTTGCAAGGGTTTCCGCCCGT
TTTTCGGCCACCGCTAACCTGTCTTTTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCTGCGCC
CTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCTCGAACCCTCCCGGCCCGCTAACGCGGGCCTCCCAT
CCCCCCAGGGGCTGCGCCCCTCGGCCGCGAACGGCCTCACCCCAAAAATGGCAGCGCTGGCAGTCCTTGCCATTGCCGGG
ATCGGGGCAGTAACGGGATGGGCGATCAGCCCGAGCGCGACGCCCGGAAGCATTGACGTGCCGCAGGTGCTGGCATCGAC
ATTCAGCGACCAGGTGCCGGGCAGTGAGGGCGGCGGCCTGGGTGGCGGCCTGCCCTTCACTTCGGCCGTCGGGGCATTCA
CGGACTTCATGGCGGGGCCGGCAATTTTTACCTTGGGCATTCTTGGCATAGTGGTCGCGGGTGCCGTGCTCGTGTTCGGG
GGTGCGATAAACCCAGCGAACCATTTGAGGTGATAGGTAAGATTATACCGAGGTATGAAAACGAGAATTGGACCTTTACA
GAATTACTCTATGAAGCGCCATATTTAAAAAGCTACCAAGACGAAGAGGATGAAGAGGATGAGGAGGCAGATTGCCTTGA
ATATATTGACAATACTGATAAGATAATATATCTTTTATATAGAAGATATCGCCGTATGTAAGGATTTCAGGGGGCAAGGC
ATAGGCAGCGCGCTTATCAATATATCTATAGAATGGGCAAAGCATAAAAACTTGCATGGACTAATGCTTGAAACCCAGGA
CAATAACCTTATAGCTTGTAAATTCTATCATAATTGGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAAT
GCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTC
AGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATA
CAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAG
TGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGACTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTA
GCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGA
CTGCGGCCTGAGTTTTTTAAGTGACGTAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCTGTTGCCCGGCATCCAAC
GCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTT
TACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAG
GAGGGACAGCTGATAGACACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCAT
CACCCATAATTGTGGTTTCAAAATCGGCTCCGTCGATACTATGTTATACGCCAACTTTGAAAACAACTTTGAAAAAGCTG
TTTTCTGGTATTTAAGGTTTTAGAATGCAAGGAACAGTGAATTGGAGTTCGTCTTGTTATAATTAGCTTCTTGGGGTATC
TTTAAATACTGTAGAAAAGAGGAAGGAAATAATAAATGGCTAAAATGAGAATATCACCGGAATTGAAAAAACTGATCGAA
AAATACCGCTGCGTAAAAGATACGGAAGGAATGTCTCCTGCTAAGGTATATAAGCTGGTGGGAGAAAATGAAAACCTATA
TTTAAAAATGACGGACAGCCGGTATAAAGGGACCACCTATGATGTGGAACGGGAAAAGGACATGATGCTATGGCTGGAAG
GAAAGCTGCCTGTTCCAAAGGTCCTGCACTTTGAACGGCATGATGGCTGGAGCAATCTGCTCATGAGTGAGGCCGATGGC
GTCCTTTGCTCGGAAGAGTATGAAGATGAACAAAGCCCTGAAAAGATTATCGAGCTGTATGCGGAGTGCATCAGGCTCTT
TCACTCCATCGACATATCGGATTGTCCCTATACGAATAGCTTAGACAGCCGCTTAGCCGAATTGGATTACTTACTGAATA
ACGATCTGGCCGATGTGGATTGCGAAAACTGGGAAGAAGACACTCCATTTAAAGATCCGCGCGAGCTGTATGATTTTTTA
AAGACGGAAAAGCCCGAAGAGGAACTTGTCTTTTCCCACGGCGACCTGGGAGACAGCAACATCTTTGTGAAAGATGGCAA
AGTAAGTGGCTTTATTGATCTTGGGAGAAGCGGCAGGGCGGACAAGTGGTATGACATTGCCTTCTGCGTCCGGTCGATCA
GGGAGGATATCGGGGAAGAACAGTATGTCGAGCTATTTTTTGACTTACTGGGGATCAAGCCTGATTGGGAGAAAATAAAA
TATTATATTTTACTGGATGAATTGTTTTAGTACCTAGATGTGGCGCAACGATGCCGGCGACAAGCAGGAGCGCACCGACT
TCTTCCGCATCAAGTGTTTTGGCTCTCAGGCCGAGGCCCACGGCAAGTATTTGGGCAAGGGGTCGCTGGTATTCGTGCAG
GGCAAGATTCGGAATACCAAGTACGAGAAGGACGGCCAGACGGTCTACGGGACCGACTTCATTGCCGATAAGGTGGATTA
TCTGGACACCAAGGCACCAGGCGGGTCAAATCAGGAATAAGGGCACATTGCCCCGGCGTGAGTCGGGGCAATCCCGCAAG
GAGGGTGAATGAATCGGACGTTTGACCGGAAGGCATACAGGCAAGAACTGATCGACGCGGGGTTTTCCGCCGAGGATGCC
GAAACCATCGCAAGCCGCACCGTCATGCGTGCGCCCCGCGAAACCTTCCAGTCCGTCGGCTCGATGGTCCAGCAAGCTAC
GGCCAAGATCGAGCGCGACAGCGTGCAACTGGCTCCCCCTGCCCTGCCCGCGCCATCGGCCGCCGTGGAGCGTTCGCGTC
GTCTCGAACAGGAGGCGGCAGGTTTGGCGAAGTCGATGACCATCGACACGCGAGGAACTATGACGACCAAGAAGCGAAAA
ACCGCCGGCGAGGACCTGGCAAAACAGGTCAGCGAGGCCAAGCAGGCCGCGTTGCTGAAACACACGAAGCAGCAGATCAA
GGAAATGCAGCTTTCCTTGTTCGATATTGCGCCGTGGCCGGACACGATGCGAGCGATGCCAAACGACACGGCCCGCTCTG
CCCTGTTCACCACGCGCAACAAGAAAATCCCGCGCGAGGCGCTGCAAAACAAGGTCATTTTCCACGTCAACAAGGACGTG
AAGATCACCTACACCGGCGTCGAGCTGCGGGCCGACGATGACGAACTGGTGTGGCAGCAGGTGTTGGAGTACGCGAAGCG
CACCCCTATCGGCGAGCCGATCACCTTCACGTTCTACGAGCTTTGCCAGGACCTGGGCTGGTCGATCAATGGCCGGTATT
ACACGAAGGCCGAGGAATGCCTGTCGCGCCTACAGGCGACGGCGATGGGCTTCACGTCCGACCGCGTTGGGCACCTGGAA
TCGGTGTCGCTGCTGCACCGCTTCCGCGTCCTGGACCGTGGCAAGAAAACGTCCCGTTGCCAGGTCCTGATCGACGAGGA
AATCGTCGTGCTGTTTGCTGGCGACCACTACACGAAATTCATATGGGAGAAGTACCGCAAGCTGTCGCCGACGGCCCGAC
GGATGTTCGACTATTTCAGCTCGCACCGGGAGCCGTACCCGCTCAAGCTGGAAACCTTCCGCCTCATGTGCGGATCGGAT
TCCACCCGCGTGAAGAAGTGGCGCGAGCAGGTCGGCGAAGCCTGCGAAGAGTTGCGAGGCAGCGGCCTGGTGGAACACGC
CTGGGTCAATGATGACCTGGTGCATTGCAAACGCTAGGGCCTTGTGGGGTCAGTTCCGGCTGGGGGTTCAGCAGCCAGCG
CTTTACTGGCATTTCAGGAACAAGCGGGCACTGCTCGACGCACTTGCTTCGCTCAGTATCGCTCGGGACGCACGGCGCGC
TCTACGAACTGCCGATAAACAGAGGATTAAAATTGACAATTGTGATTAAGGCTCAGATTCGACGGCTTGGAGCGGCCGAC
GTGCAGGATTTCCGCGAGATCCGATTGTCGGCCCTGAAGAAAGCTCCAGAGATGTTCGGGTCCGTTTACGAGCACGAGGA
GAAAAAGCCCATGGAGGCGTTCGCTGAACGGTTGCGAGATGCCGTGGCATTCGGCGCCTACATCGACGGCGAGATCATTG
GGCTGTCGGTCTTCAAACAGGAGGACGGCCCCAAGGACGCTCACAAGGCGCATCTGTCCGGCGTTTTCGTGGAGCCCGAA
CAGCGAGGCCGAGGGGTCGCCGGTATGCTGCTGCGGGCGTTGCCGGCGGGTTTATTGCTCGTGATGATCGTCCGACAGAT
TCCAACGGGAATCTGGTGGATGCGCATCTTCATCCTCGGCGCACTTAATATTTCGCTATTCTGGAGCTTGTTGTTTATTT
CGGTCTACCGCCTGCCGGGCGGGGTCGCGGCGACGGTAGGCGCTGTGCAGCCGCTGATGGTCGTGTTCATCTCTGCCGCT
CTGCTAGGTAGCCCGATACGATTGATGGCGGTCCTGGGGGCTATTTGCGGAACTGCGGGCGTGGCGCTGTTGGTGTTGAC
ACCAAACGCAGCGCTAGATCCTGTCGGCGTCGCAGCGGGCCTGGCGGGGGCGGTTTCCATGGCGTTCGGAACCGTGCTGA
CCCGCAAGTGGCAACCTCCCGTGCCTCTGCTCACCTTTACCGCCTGGCAACTGGCGGCCGGAGGACTTCTGCTCGTTCCA
GTAGCTTTAGTGTTTGATCCGCCAATCCCGATGCCTACAGGAACCAATGTTCTCGGCCTGGCGTGGCTCGGCCTGATCGG
AGCGGGTTTAACCTACTTCCTTTGGTTCCGGGGGATCTCGCGACTCGAACCTACAGTTGTTTCCTTACTGGGCTTTCTCA
GCCCCAGATCTGGGGTCGATCAGCCGGGGATGCATCAGGCCGACAGTCGGAACTTCGGGTCCCCGACCTGTACCATTCGG
TGAGCAATGGATAGGGGAGTTGATATCGTCAACGTTCACTTCTAAAGAAATAGCGCCACTCAGCTTCCTCAGCGGCTTTA
TCCAGCGATTTCCTATTATGTCGGCATAGTTCTCAAGATCGACAGCCTGTCACGGTTAAGCGAGAAATGAATAAGAAGGC
TGATAATTCGGATCTCTGCGAGGGAGATGATATTTGATCACAGGCAGCAACGCTCTGTCATCGTTACAATCAACATGCTA
CCCTCCGCGAGATCATCCGTGTTTCAAACCCGGCAGCTTAGTTGCCGTTCTTCCGAATAGCATCGGTAACATGAGCAAAG
TCTGCCGCCTTACAACGGCTCTCCCGCTGACGCCGTCCCGGACTGATGGGCTGCCTGTATCGAGTGGTGATTTTGTGCCG
AGCTGCCGGTCGGGGAGCTGTTGGCTGGCTGGTGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAA
TAACACATTGCGGACGTTTTTAATGTACTGGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTC
ACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGT
TCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAG
TCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCAT
CACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCT
TGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCCATTCAGGCTGCGCAACT
GTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGT
TGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTC
TAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACA
ATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGC
GTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAG
GCGGTTTGCGTATTGGGCCAAAGACAAAAGGGCGACATTCAACCGATTGAGGGAGGGAAGGTAAATATTGACGGAAATTA
TTCATTAAAGGTGAATTATCACCGTCACCGACTTGAGCCATTTGGGAATTAGAGCCAGCAAAATCACCAGTAGCACCATT
ACCATTAGCAAGGCCGGAAACGTCACCAATGAAACCATCGATAGCAGCACCGTAATCAGTAGCGACAGAATCAAGTTTGC
CTTTAGCGTCAGACTGTAGCGCGTTTTCATCGGCATTTTCGGTCATAGCCCCCTTATTAGCGTTTGCCATCTTTTCATAA
TCAAAATCACCGGAACCAGAGCCACCACCGGAACCGCCTCCCTCAGAGCCGCCACCCTCAGAACCGCCACCCTCAGAGCC
ACCACCCTCAGAGCCGCCACCAGAACCACCACCAGAGCCGCCGCCAGCATTGACAGGAGGCCCGATCTAGTAACATAGAT
GACACCGCGCGCGATAATTTATCCTAGTTTGCGCGCTATATTTTGTTTTCTATCGCGTATTAAATGTATAATTGCGGGAC
TCTAATCATAAAAACCCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATGCTTAACGTAATTCAACAGAA
ATTATATGATAATCATCGCAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCCAAATGTTTGAACGATCGGGG
ATCATCCGGGTCTGTGGCGGGAACTCCACGAAAATATCCGAACGCAGCAAGATATCGCGGTGCATCTCGGTCTTGCCTGG
GCAGTCGCCGCCGACGCCGTTGATGTGGACGCCGGGCCCGATCATATTGTCGCTCAGGATCGTGGCGTTGTGCTTGTCGG
CCGTTGCTGTCGTAATGATATCGGCACCTTCGACCGCCTGTTCCGCAGAGATCCCGTGGGCGAAGAACTCCAGCATGAGA
TCCCCGCGCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGAAGGCGGCGGTGGA
ATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTC
AAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGC
CGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCG
ATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCATCGCC
GTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGAT
CGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGA
TCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATC
CTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGC
CCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAA
AGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCC
GAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCAGATCCGG
TGCAGATTATTTGGATTGAGAGTGAATATGAGACTCTAATTGGATACCGAGGGGAATTTATGGAACGTCAGTGGAGCATT
TTTGACAAGAAATATTTGCTAGCTGATAGTGACCTTAGGCGACTTTTGAACGCGCAATAATGGTTTCTGACGTATGTGCT
TAGCTCATTAAACTCCAGAAACCCGCGGCTGAGTGGCTCCTTCAACGTTGCGGTTCTGTCAGTTCCAAACGTAAAACGGC
TTGTCCCGCGTCATCGGCGGGGGTCATAACGTGACTCCCTTAATTCTCCGCTCATGATCAGATTGTCGTTTCCCGCCTTC
AGTTTAAACTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTAAGAGAAAAGAGCGTTTATTAGAATAATCGGATA
TTTAAAAGGGCGTGAAAAGGTTTATCCGTTCGTCCATTTGTATGTGCATGCCAACCACAGGGTTCCCCAGATCTGGCGCC
GGCCAGCGAGACGAGCAAGATTGGCCGCCGCCCGAAACGATCCGACAGCGCGCCCAGCACAGGTGCGCAGGCAAATTGCA
CCAACGCATACAGCGCCAGCAGAATGCCATAGTGGGCGGTGACGTCGTTCGAGTGAACCAGATCGCGCAGGAGGCCCGGC
AGCACCGGCATAATCAGGCCGATGCCGACAGCGTCGAGCGCGACAGTGCTCAGAATTACGATCAGGGGTATGTTGGGTTT
CACGTCTGGCCTCCGGACCAGCCTCCGCTGGTCCGATTGAACGCGCGGATTCTTTATCACTGATAAGTTGGTGGACATAT
TATGTTTATCAGTGATAAAGTGTCAAGCATGACAAAGTTGCAGCCGAATACAGTGATCCGTGCCGCCCTGGACCTGTTGA
ACGAGGTCGGCGTAGACGGTCTGACGACACGCAAACTGGCGGAACGGTTGGGGGTTCAGCAGCCGGCGCTTTACTGGCAC
TTCAGGAACAAGCGGGCGCTGCTCGACGCACTGGCCGAAGCCATGCTGGCGGAGAATCATACGCATTCGGTGCCGAGAGC
CGACGACGACTGGCGCTCATTTCTGATCGGGAATGCCCGCAGCTTCAGGCAGGCGCTGCTCGCCTACCGCGATGGCGCGC
GCATCCATGCCGGCACGCGACCGGGCGCACCGCAGATGGAAACGGCCGACGCGCAGCTTCGCTTCCTCTGCGAGGCGGGT
TTTTCGGCCGGGGACGCCGTCAATGCGCTGATGACAATCAGCTACTTCACTGTTGGGGCCGTGCTTGAGGAGCAGGCCGG
CGACAGCGATGCCGGCGAGCGCGGCGGCACCGTTGAACAGGCTCCGCTCTCGCCGCTGTTGCGGGCCGCGATAGACGCCT
TCGACGAAGCCGGTCCGGACGCAGCGTTCGAGCAGGGACTCGCGGTGATTGTCGATGGATTGGCGAAAAGGAGGCTCGTT
GTCAGGAACGTTGAAGGACCGAGAAAGGGTGACGATTGATCAGGACCGCTGCCGGAGCGCAACCCACTCACTACAGCAGA
GCCATGTAGACAACATCCCCTCCCCCTTTCCACCGCGTCAGACGCCCGTAGCAGCCCGCTACGGGCTTTTTCATGCCCTG
CCCTAGCGTCCAAGCCTCACGGCCGCGCTCGGCCTCTCTGGCGGCCTTCTGGCGCTCTTCCGCTTCCTCGCTCACTGACT
CGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGG
GATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTT
CCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAA
GATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCC
TTTCTCCCTTCGGGAAGCGTGGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATC
CATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCG
GGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAA
CGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATGAGGGCAAGCGGATGGCTGATGAAACCAAGC
CAACCAGGAAGGGCAGCCCACCTATCAAGGTGTACTGCCTTCCAGACGAACGAAGAGCGATTGAGGAAAAGGCGGCGGCG
GCCGGCATGAGCCTGTCGGCCTACCTGCTGGCCGTCGGCCAGGGCTACAAAATCACGGGCGTCGTGGACTATGAGCACGT
CCGCGAGCTGGCCCGCATCAATGGCGACCTGGGCCGCCTGGGCGGCCTGCTGAAACTCTGGCTCACCGACGACCCGCGCA
CGGCGCGGTTCGGTGATGCCACGATCCTCGCCCTGCTGGCGAAGATCGAAGAGAAGCAGGACGAGCTTGGCAAGGTCATG
ATGGGCGTGGTCCGCCCGAGGGCAGAGCCATGACTTTTTTAGCCGCTAAAACGGCCGGGGGGTGCGCGTGATTGCCAAGC
ACGTCCCCATGCGCTCCATCAAGAAGAGCGACTTCGCGGAGCTGGTGAAGTACATCACCGACGAGCAAGGCAAGACCGAG
CGCCTTTGCGACGCTCA

//

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart