pBIND- ID Plasmid

$182.00

  • Model: PVT1702
  • 50 Units in Stock
Ask a question


Add to Cart:

pBIND-ID

Search name

pBIND-ID,Plasmid pBIND-ID,pBIND-ID vector

pBIND-ID Plasmid information

Bacterial Resistance:Ampicillin
Growth Strain:DH5a

Promoter: T7, CMV
Replicator: pUC, ori, F1, ori
Terminator: SV40, poly (A) signal
Plasmid classification: mammalian cells, mammalian cells, two hybrid vectors
Prokaryotic resistance: Amp
Clone strain: DH5 alpha
Culture conditions: 37 DEG C, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, transient expression
Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG
Primers for 3'sequencing: primers were designed according to sequences

pBIND-ID Plasmid Description

The protein product of the Id cDNA sequence in the pBIND-Id Vector is known to interact with the protein product of the MyoD cDNA sequence in the pACT-MyoD Vector.

pBIND-ID Plasmid Sequence

GGCTCGTTTAGTGACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCA
CAGTTAAATTGCTAACGCAGTCAGTGCTTCTGACACGACAGTCTCGAACTTAA
GCTGCAGTGACTCTCTTAAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGG
GCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAAAAACTGG
GCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTT
ACTGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGTTCAATTA
CAGCTCTTAAGGCTAGAGTACTTAATACGACTCACTATAGGCTAGCCAGCTTG
AAGCAAGCCTCCTGAAAGATGAAGCTACTGTCTTCTATCGAACAAGCATGCGA
TATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCA
AGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCT
CCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGA
ACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATTTTGAAAA
TGGATTCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTGTACAAGAT
AATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATAT
GCCTCTAACATTGAGACAGCATAGAATAAGTGCGACATCATCATCGGAAGAGA
GTAGTAACAAAGGTCAAAGACAGTTGACTGTATCGCCGGAATTCCCGGGGATC
CGTCGACATAAATTCCCACTTGGTCTGTCAGAGCAAAGCGTGGCCATCTCGCG
CTGCGCTGGGACGCGCCTGCCCGCCTTGCTGGACGAGCAGCAGTGAACGTCCT
GCTCTACGACATGAACGGCTGCTACTCACGCCTCAAGGAGCTGGTG

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart