pBiT1.1-N [TK-LgBiT]

$232.00

  • Model: PVT18339
  • 50 Units in Stock
Ask a question


Add to Cart:

pBiT1.1-N [TK-LgBiT]

 

Product Name: pBiT1.1-N [TK-LgBiT]
Cat No.: PVT18339
Alternative Name: pBiT1.1-N [TK-LgBiT],pBiT1.1-N [TK-LgBiT] vector,pBiT1.1-N [TK-LgBiT] plasmid,pBiT1.1-N [TK-LgBiT] map,pBiT1.1-N [TK-LgBiT] sequence
Plasmid form: Freeze-dried powder
Storage Condition: -20 Centigrade
Bulk order Please contact us: sales@lifescience-market.com
Promoter: TK
Bacterial Resistance(s): Amp
Screening: -
Growth Strain(s): DH5alpha
Culture Medium: LB
Temperature: 37 Centigrade
Vector Size: 3858 bp


pBiT1.1-N [TK-LgBiT] Sequence

GGCCTAACTGGCCGGTACCTGAGTCTAAATGAGTCTTCGGACCTCGCGGGGGCCGCTTAAGCGGTGGTTAGGGTTTGTCT
GACGCGGGGGGAGGGGGAAGGAACGAAACACTCTCATTCGGAGGCGGCTCGGGGTTTGGTCTTGGTGGCCACGGGCACGC
AGAAGAGCGCCGCGATCCTCTTAAGCACCCCCCCGCCCTCCGTGGAGGCGGGGGTTTGGTCGGCGGGTGGTAACTGGCGG
GCCGCTGACTCGGGCGGGTCGCGCGCCCCAGAGTGTGACCTTTTCGGTCTGCTCGCAGACCCCCGGGCGGCGCCGCCGCG
GCGGCGACGGGCTCGCTGGGTCCTAGGCTCCATGGGGACCGTATACGTGGACAGGCTCTGGAGCATCCGCACGACTGCGG
TGATATTACCGGAGACCTTCTGCGGGACGAGCCGGGTCACGCGGCTGACGCGGAGCGTCCGTTGGGCGACAAACACCAGG
ACGGGGCACAGGTACACTATCTTGTCACCCGGAGGCGCGAGGGACTGCAGGAGCTTCAGGGAGTGGCGCAGCTGCTTCAT
CCCCGTGGCCCGTTGCTCGCGTTTGCTGGCGGTGTCCCCGGAAGAAATATATTTGCATGTCTTTAGTTCTATGATGACAC
AAACCCCGCCCAGCGTCTTGTCATTGGCGAAGTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCCAGGTCCACTTCG
CATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAAAAGCTTGGCAATCCGGTACTG
TTGGTAAAGCCACCATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGGAACAGACAGCCGCCTACAACCTGGACCAA
GTCCTTGAACAGGGAGGTGTGTCCAGTTTGCTGCAGAATCTCGCCGTGTCCGTAACTCCGATCCAAAGGATTGTCCGGAG
CGGTGAAAATGCCCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGCCGACCAAATGGCCCAGATCG
AAGAGGTGTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCCCTATGGCACACTGGTAATCGAC
GGGGTTACGCCGAACATGCTGAACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGT
AACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCACCCCCGACGGCTCCATGCTGTTCCGAGTAA
CCATCAACAGTGGGAGTTCCGGTGGTGGCGGGAGCGGAGGTGGAGGCTCGAGCGGTGGAGCTCAGGGGAATTCAGTCTAA
GCTAGCAGATCTTCTAGAGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACC
ACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTG
CAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCA
AGTAAAACCTCTACAAATGTGGTAAAATCGATAAGGATCCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTC
CTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGC
CGGCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTC
AAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCA
GGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCA
AGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGT
TCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTA
GGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCC
TTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGAT
TAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTAT
TTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCT
GGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTC
TACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCT
AGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGCGGCCGCAAA
TGCTAAACCACTGCAGTGGTTACCAGTGCTTGATCAGTGAGGCACCGATCTCAGCGATCTGCCTATTTCGTTCGTCCATA
GTGGCCTGACTCCCCGTCGTGTAGATCACTACGATTCGTGAGGGCTTACCATCAGGCCCCAGCGCAGCAATGATGCCGCG
AGAGCCGCGTTCACCGGCCCCCGATTTGTCAGCAATGAACCAGCCAGCAGGGAGGGCCGAGCGAAGAAGTGGTCCTGCTA
CTTTGTCCGCCTCCATCCAGTCTATGAGCTGCTGTCGTGATGCTAGAGTAAGAAGTTCGCCAGTGAGTAGTTTCCGAAGA
GTTGTGGCCATTGCTACTGGCATCGTGGTATCACGCTCGTCGTTCGGTATGGCTTCGTTCAACTCTGGTTCCCAGCGGTC
AAGCCGGGTCACATGATCACCCATATTATGAAGAAATGCAGTCAGCTCCTTAGGGCCTCCGATCGTTGTCAGAAGTAAGT
TGGCCGCGGTGTTGTCGCTCATGGTAATGGCAGCACTACACAATTCTCTTACCGTCATGCCATCCGTAAGATGCTTTTCC
GTGACCGGCGAGTACTCAACCAAGTCGTTTTGTGAGTAGTGTATACGGCGACCAAGCTGCTCTTGCCCGGCGTCTATACG
GGACAACACCGCGCCACATAGCAGTACTTTGAAAGTGCTCATCATCGGGAATCGTTCTTCGGGGCGGAAAGACTCAAGGA
TCTTGCCGCTATTGAGATCCAGTTCGATATAGCCCACTCTTGCACCCAGTTGATCTTCAGCATCTTTTACTTTCACCAGC
GTTTCGGGGTGTGCAAAAACAGGCAAGCAAAATGCCGCAAAGAAGGGAATGAGTGCGACACGAAAATGTTGGATGCTCAT
ACTCGTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTACTAGTACGTCTCTCAAGGATAAGTAAGTAATATTAAGG
TACGGGAGGTATTGGACAGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGAT
AGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAG
GTGCCAGAACATTTCTCT
//

*Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart