pBiT2.1-C [TK-SmBiT]

$232.00

  • Model: PVT18269
  • 50 Units in Stock
Ask a question


Add to Cart:

pBiT2.1-C [TK-SmBiT]

 

Product Name: pBiT2.1-C [TK-SmBiT]
Cat No.: PVT18269
Alternative Name: pBiT2.1-C [TK-SmBiT],pBiT2.1-C [TK-SmBiT] vector,pBiT2.1-C [TK-SmBiT] plasmid,pBiT2.1-C [TK-SmBiT] map,pBiT2.1-C [TK-SmBiT] sequence
Plasmid form: Freeze-dried powder
Storage Condition: -20 Centigrade
Bulk order Please contact us: sales@lifescience-market.com
Promoter: TK
Bacterial Resistance(s): Amp
Screening: -
Growth Strain(s): DH5alpha
Culture Medium: LB
Temperature: 37 Centigrade
Vector Size: 3423 bp

 

pBiT2.1-C [TK-SmBiT] Sequence

GGCCTAACTGGCCGGTACCTGAGTCTAAATGAGTCTTCGGACCTCGCGGGGGCCGCTTAAGCGGTGGTTAGGGTTTGTCT
GACGCGGGGGGAGGGGGAAGGAACGAAACACTCTCATTCGGAGGCGGCTCGGGGTTTGGTCTTGGTGGCCACGGGCACGC
AGAAGAGCGCCGCGATCCTCTTAAGCACCCCCCCGCCCTCCGTGGAGGCGGGGGTTTGGTCGGCGGGTGGTAACTGGCGG
GCCGCTGACTCGGGCGGGTCGCGCGCCCCAGAGTGTGACCTTTTCGGTCTGCTCGCAGACCCCCGGGCGGCGCCGCCGCG
GCGGCGACGGGCTCGCTGGGTCCTAGGCTCCATGGGGACCGTATACGTGGACAGGCTCTGGAGCATCCGCACGACTGCGG
TGATATTACCGGAGACCTTCTGCGGGACGAGCCGGGTCACGCGGCTGACGCGGAGCGTCCGTTGGGCGACAAACACCAGG
ACGGGGCACAGGTACACTATCTTGTCACCCGGAGGCGCGAGGGACTGCAGGAGCTTCAGGGAGTGGCGCAGCTGCTTCAT
CCCCGTGGCCCGTTGCTCGCGTTTGCTGGCGGTGTCCCCGGAAGAAATATATTTGCATGTCTTTAGTTCTATGATGACAC
AAACCCCGCCCAGCGTCTTGTCATTGGCGAAGTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCCAGGTCCACTTCG
CATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAAAAGCTTGGCAATCCGGTACTG
TGGTAAAGCCACCAGATCTGCTAGCGATCGCCTAAGTGGGAGCTCAGGGGAATTCTGGCTCGAGCGGTGGTGGCGGGAGC
GGAGGTGGAGGGTCGTCAGGTGTGACCGGCTACCGGCTGTTCGAGGAGATTCTGTAATCTAGAGTCGGGGCGGCCGGCCG
CTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTG
TGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATT
TTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAATCGATAAG
GATCCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCG
CACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTTCCGCTTCCTCGCTCACTGACTC
GCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGG
ATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTC
CATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAG
ATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCT
TTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAG
CTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGT
AAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGT
TCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTC
GGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGAT
TACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCAC
GTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCA
ATCTAAAGTATATATGAGTAAACTTGGTCTGACAGCGGCCGCAAATGCTAAACCACTGCAGTGGTTACCAGTGCTTGATC
AGTGAGGCACCGATCTCAGCGATCTGCCTATTTCGTTCGTCCATAGTGGCCTGACTCCCCGTCGTGTAGATCACTACGAT
TCGTGAGGGCTTACCATCAGGCCCCAGCGCAGCAATGATGCCGCGAGAGCCGCGTTCACCGGCCCCCGATTTGTCAGCAA
TGAACCAGCCAGCAGGGAGGGCCGAGCGAAGAAGTGGTCCTGCTACTTTGTCCGCCTCCATCCAGTCTATGAGCTGCTGT
CGTGATGCTAGAGTAAGAAGTTCGCCAGTGAGTAGTTTCCGAAGAGTTGTGGCCATTGCTACTGGCATCGTGGTATCACG
CTCGTCGTTCGGTATGGCTTCGTTCAACTCTGGTTCCCAGCGGTCAAGCCGGGTCACATGATCACCCATATTATGAAGAA
ATGCAGTCAGCTCCTTAGGGCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCGGTGTTGTCGCTCATGGTAATGGCAGCA
CTACACAATTCTCTTACCGTCATGCCATCCGTAAGATGCTTTTCCGTGACCGGCGAGTACTCAACCAAGTCGTTTTGTGA
GTAGTGTATACGGCGACCAAGCTGCTCTTGCCCGGCGTCTATACGGGACAACACCGCGCCACATAGCAGTACTTTGAAAG
TGCTCATCATCGGGAATCGTTCTTCGGGGCGGAAAGACTCAAGGATCTTGCCGCTATTGAGATCCAGTTCGATATAGCCC
ACTCTTGCACCCAGTTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCGGGGTGTGCAAAAACAGGCAAGCAAAATGC
CGCAAAGAAGGGAATGAGTGCGACACGAAAATGTTGGATGCTCATACTCGTCCTTTTTCAATATTATTGAAGCATTTATC
AGGGTTACTAGTACGTCTCTCAAGGATAAGTAAGTAATATTAAGGTACGGGAGGTATTGGACAGGCCGCAATAAAATATC
TTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCAAAACAAAACGA
AACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT
//

 

Caution:
Product is for research use only!

 

*Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart