pBluescript II KS+ Plasmid

$215.00

  • Model: PVT0012
  • 50 Units in Stock
Ask a question


Add to Cart:

pBluescript II KS+ Plasmid

Search name

pBluescript II KS+,Plasmid pBluescript II KS+,pBluescript II KS+ vector

 

 

pBluescript II-KS(+) Plasmid Informaiton
Function E.coli Cloning plasmid

Replicator: ColE1 ori, F1 ori

Plasmid classification: large intestine series plasmid; large intestine clone plasmid; phage display plasmid.

Plasmid size: 2961bp

Plasmid label: LacZ

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

5'sequencing primers: T7 (TAATACGACTCACTATAGGG)

3'sequencing primers: T3 (ATTAACCCTCACTAAAGGGA)

Note: Blue leukoplakia screening, producing single strand DNA

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart