pBluescript II- SK (+)


  • Model: PVT10567
  • 50 Units in Stock
Ask a question

Add to Cart:

pBluescript II-SK(+)

Catalog No. PVT10567
Packing 2ug


pBluescript II-SK(+) Information

Function E.coli Cloning plasmid

Replicator: ColE1 ori, F1 ori

Plasmid classification: large intestine series plasmid; large intestine clone plasmid; phage display plasmid.

Plasmid size: 2961bp

Plasmid label: LacZ

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

5'sequencing primers: T7 (TAATACGACTCACTATAGGG)

3'sequencing primers: T3 (ATTAACCCTCACTAAAGGGA)

Note: Blue leukoplakia screening, producing single strand DNA


pBluescript II-SK(+) Description

PBluescript II-KS (+) is the plasmids of Escherichia coli. It is a cloned carrier, which is derived from phage. This vector is often used in cloning and sequencing, including DNA sequencing, nested deletion, RNA transcription, site directed mutagenesis and gene mapping in vitro. PBluescript II-KS (+) contains 21 unique restriction endonuclease loci. Both T7 and T3 RNA polymerase promoter sequences are located on both sides of the MCS region, which mainly help RNA in vitro synthesis. The differences of pBluescript II SK (+) and pBluescript II KS (+) exist only in the direction of polyclonal sites.

Standard cloning vector (phagemid excised from lambda ZAPII). The f1 (+) orientation allows rescue of sense strand ssDNA. pBluescript II KS(+) and pBluescript II SK(+) differ by the orientation of the MCS.

pBluescript II SK(+)



pBluescript II-SK(+) Sequence

LOCUS       Exported                2961 bp ds-DNA     circular SYN 26-JUN-2017

DEFINITION  synthetic circular DNA

KEYWORDS    pBluescript II-SK(+)

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 2961)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, June 26, 2017

FEATURES             Location/Qualifiers

     source          1..2961

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     rep_origin      complement(3..458)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     CDS             complement(241..816)


                     /gene="lacZ fragment"

                     /product="LacZ-alpha fragment of beta-galactosidase"






     primer_bind     600..616

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     promoter        626..644

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     misc_feature    653..760


                     /note="pBluescript multiple cloning site"

     promoter        complement(773..791)

                     /note="T3 promoter"

                     /note="promoter for bacteriophage T3 RNA polymerase"

     primer_bind     complement(812..828)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    836..852

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(860..890)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    905..926

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     rep_origin      complement(1214..1802)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(1973..2833)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(2834..2938)


                     /note="AmpR promoter"


        1 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc

       61 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga

      121 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc

      181 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc

      241 ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag

      301 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa

      361 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac

      421 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg

      481 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg

      541 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg

      601 taaaacgacg gccagtgagc gcgcgtaata cgactcacta tagggcgaat tgggtaccgg

      661 gccccccctc gaggtcgacg gtatcgataa gcttgatatc gaattcctgc agcccggggg

      721 atccactagt tctagagcgg ccgccaccgc ggtggagctc cagcttttgt tccctttagt

      781 gagggttaat tgcgcgcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt

      841 atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg

      901 cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg

      961 gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc

     1021 gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc

     1081 ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata

     1141 acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg

     1201 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct

     1261 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa

     1321 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc

     1381 tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt

     1441 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg

     1501 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg

     1561 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct

     1621 tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc

     1681 tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg

     1741 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc

     1801 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt

     1861 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa

     1921 aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat

     1981 gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct

     2041 gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg

     2101 caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag

     2161 ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta

     2221 attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg

     2281 ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg

     2341 gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct

     2401 ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta

     2461 tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg

     2521 gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc

     2581 cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg

     2641 gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga

     2701 tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg

     2761 ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat

     2821 gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc

     2881 tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca

     2941 catttccccg aaaagtgcca c



Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
